휴먼 HNRNPM Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
    휴먼 HNRNPM cDNA 클론 제품 정보
    Gene_bank_ref_id:BC000138
    cDNA 크기:2193bp
    cDNA 설명:Full length Clone DNA of Homo sapiens heterogeneous nuclear ribonucleoprotein M.
    유전자 동의어:CEAR, DKFZp547H118, HNRNPM4, HNRPM, HNRPM4, HTGR1, NAGR1, hnRNP M, HNRNPM
    :Human
    벡터:pCMV3-untagged
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HNRNPM qPCR primers for gene expression analysis, HP102878 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".