휴먼 HSF1 Gene ORF cDNA clone expression plasmid, C-HA 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 HSF1 cDNA 클론 제품 정보
    Gene_bank_ref_id:BC014638
    cDNA 크기:1590bp
    cDNA 설명:Full length Clone DNA of Homo sapiens heat shock transcription factor 1 with C terminal HA tag.
    유전자 동의어:HSTF1, HSF1
    :Human
    벡터:pCMV3-C-HA
    Plasmid:
    제한 사이트:
    태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HSF1 qPCR primers for gene expression analysis, HP101902 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    연구배경

    Heat shock factor protein 1, also known as heat shock transcription factor 1, HSF1 and HSTF1, is a cytoplasm and nucleus protein which belongs to the HSF family. HSF1 is the major transcription factor of HSPs (heat shock proteins) in response to various stresses. Wild type HSF1 (heat shock transcriptional factor 1) is normally inactive. HSF1 / HSTF1 is a DNA-binding protein that specifically binds heat shock promoter elements (HSE) and activates transcription. In higher eukaryotes, HSF is unable to bind to the HSE unless the cells are heat shocked. HSF1 / HSTF1 protects cells and organisms against various types of stress, either by triggering a complex response that promotes cell survival or by triggering cell death when stress-induced alterations cannot be rescued. HSF1 / HSTF1 is the key protein in regulating stress response. It can be activated under heat, oxidative or another stress conditions. Dominant-positive and dominant-negative HSF1 are two types of HSF1 mutants. Both of them gain the DNA binding activity in the absence of stress. In addition, dominant-positive HSF1 acquires transcriptional activity, which dominant-negative HSF1 does not acquire. HSF1 / HSTF1 was also reported to contribute to cell resistance against genotoxic stress, such as that caused by doxorubicin, an anticancer drug in common clinical use.

    참고자료
  • Holmberg,C.I. et al., 2000, Cell Stress Chaperones.5 (3):219-28.
  • Huang,Y.H. et al., 2007, Sheng Wu Gong Cheng Xue Bao. 23 (6): 971-5.
  • Salmand,P.A. et al.,2008, Biol Reprod  79 (6): 1092-101.
  • Lee,Y.J. et al., 2008, Cancer Res  68 (18): 7550-60.
  • Hou,Y. et al., 2009, Mol Biol Rep. 36 (8): 2271-7.
  • Size / Price
    Cat No: HG12245-CY
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".