GRP78 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG12063-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All GRP78 Reagents

CRO Services

Product recommended


All GRP78 Reagents

GRP78 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1965 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 2kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GRP78 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GRP78 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images

Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614

GRP78 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

BIP cDNA ORF Clone, Human;GRP78 cDNA ORF Clone, Human;HEL-S-89n cDNA ORF Clone, Human;MIF2 cDNA ORF Clone, Human

GRP78 Background Information

Full Name
heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)

GRP78 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GRP78 cDNA ORF Clone in Cloning Vector, Rat RG81001-U
GRP78 cDNA ORF Clone, Rat, untagged RG81001-UT
GRP78 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81001-ACG
GRP78 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81001-ACGLN
GRP78 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81001-ANG
GRP78 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81001-ACR
GRP78 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81001-ANR
GRP78 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81001-CF
GRP78 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81001-NF
GRP78 cDNA ORF Clone, Rat, C-His tag RG81001-CH
GRP78 cDNA ORF Clone, Rat, N-His tag RG81001-NH
GRP78 cDNA ORF Clone, Rat, C-HA tag RG81001-CY
GRP78 cDNA ORF Clone, Rat, N-HA tag RG81001-NY
GRP78 cDNA ORF Clone, Rat, C-Myc tag RG81001-CM
GRP78 cDNA ORF Clone, Rat, N-Myc tag RG81001-NM
GRP78 qPCR Primer Pairs, Rat RP300965

GRP78 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GRP78 cDNA ORF Clone in Cloning Vector, Mouse MG57176-U
GRP78 cDNA ORF Clone, Mouse, untagged MG57176-UT
GRP78 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57176-ACGLN
GRP78 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57176-ACG
GRP78 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57176-ACR
GRP78 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57176-CF
GRP78 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57176-NF
GRP78 cDNA ORF Clone, Mouse, C-His tag MG57176-CH
GRP78 cDNA ORF Clone, Mouse, N-His tag MG57176-NH
GRP78 cDNA ORF Clone, Mouse, C-HA tag MG57176-CY
GRP78 cDNA ORF Clone, Mouse, N-HA tag MG57176-NY
GRP78 cDNA ORF Clone, Mouse, C-Myc tag MG57176-CM
GRP78 cDNA ORF Clone, Mouse, N-Myc tag MG57176-NM

GRP78 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GRP78 cDNA ORF Clone in Cloning Vector, Human HG12063-G
GRP78 cDNA ORF Clone, Human, untagged HG12063-UT
GRP78 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12063-ACGLN
GRP78 cDNA ORF Clone, Human, C-GFPSpark® tag HG12063-ACG
GRP78 cDNA ORF Clone, Human, N-GFPSpark® tag HG12063-ANG
GRP78 cDNA ORF Clone, Human, C-OFPSpark® tag HG12063-ACR
GRP78 cDNA ORF Clone, Human, N-OFPSpark® tag HG12063-ANR
GRP78 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12063-CF
GRP78 cDNA ORF Clone, Human, C-His tag HG12063-CH
GRP78 cDNA ORF Clone, Human, N-His tag HG12063-NH
GRP78 cDNA ORF Clone, Human, C-HA tag HG12063-CY
GRP78 cDNA ORF Clone, Human, N-HA tag HG12063-NY
GRP78 cDNA ORF Clone, Human, C-Myc tag HG12063-CM
GRP78 cDNA ORF Clone, Human, N-Myc tag HG12063-NM
GRP78 qPCR Primer Pairs, Human HP101594
info info
添加购物车成功! 添加购物车失败!