After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 IDH1 Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Human IDH1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_005896.2
cDNA 크기:1245bp
cDNA 설명:Full length Clone DNA of Homo sapiens isocitrate dehydrogenase 1 (NADP+), soluble with C terminal His tag.
유전자 동의어:IDH, IDP, IDCD, IDPC, PICD, IDH1
:Human
벡터:pCMV3-C-His
Plasmid:pCMV3-IDH1-His
제한 사이트:KpnI + XbaI (6kb + 1.29kb)
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human IDH1 Gene Plasmid Map
Human IDH1 natural ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
참고자료
  • Takano S, et al. (2011) Detection of IDH1 mutation in human gliomas: comparison of immunohistochemistry and sequencing. Brain Tumor Pathol. 28(2): 115-23.
  • Geisbrecht BV, et al. (1999) The human PICD gene encodes a cytoplasmic and peroxisomal NADP(+)-dependent isocitrate dehydrogenase. J Biol Chem. 274(43): 30527-30533.
  • Nekrutenko A, et al. (1998) Cytosolic isocitrate dehydrogenase in humans, mice, and voles and phylogenetic analysis of the enzyme family. Mol Biol Evol. 15(12): 1674-1684.
  • Henke B, et al. (1998) IDP3 encodes a peroxisomal NADP-dependent isocitrate dehydrogenase required for the beta-oxidation of unsaturated fatty acids. J Biol Chem. 273(6): 3702-3711.
  • Gabriel JL, et al. (1986) Activity of purified NAD-specific isocitrate dehydrogenase at modulator and substrate concentrations approximating conditions in mitochondria. Metabolism. 35(7): 661-667.
  • Size / Price
    Cat No: HG12055-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human IDH1 natural ORF mammalian expression plasmid, C-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".