After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 IDO1/Indoleamine 2,3‑dioxygenase Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Human IDO1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_002164.4
cDNA 크기:1212bp
cDNA 설명:Full length Clone DNA of Homo sapiens indoleamine 2,3-dioxygenase 1 with C terminal Flag tag.
유전자 동의어:IDO, INDO, IDO1
:Human
벡터:pCMV3-C-FLAG
Plasmid:pCMV3-IDO1-Flag
제한 사이트:KpnI + XbaI (6kb + 1.25kb)
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human IDO1 Gene Plasmid Map
Human IDO1 natural ORF mammalian expression plasmid, C-Flag tag
Human IDO1 Gene Expression validated Image
Human IDO1 ORF mammalian expression plasmid, C-Flag tag
[이미지를 확대하려면 클릭]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

휴먼 IDO1/Indoleamine 2,3‑dioxygenase Gene ORF cDNA clone expression plasmid, C-Flag 태그 on other vectors
휴먼 IDO1/Indoleamine 2,3‑dioxygenase Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG11650-ACG265260
휴먼 IDO1/Indoleamine 2,3‑dioxygenase Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG11650-ACR265260
휴먼 IDO1/Indoleamine 2,3‑dioxygenase Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG11650-ANG265260
휴먼 IDO1/Indoleamine 2,3‑dioxygenase Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG11650-ANR265260
휴먼 IDO1/Indoleamine 2,3‑dioxygenase Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11650-CF229890
휴먼 IDO1/Indoleamine 2,3‑dioxygenase Gene ORF cDNA clone expression plasmid, C-His 태그HG11650-CH229890
휴먼 IDO1/Indoleamine 2,3‑dioxygenase Gene ORF cDNA clone expression plasmid, C-Myc 태그HG11650-CM229890
휴먼 IDO1/Indoleamine 2,3‑dioxygenase Gene ORF cDNA clone expression plasmid, C-HA 태그HG11650-CY229890
휴먼 IDO1/Indoleamine 2,3‑dioxygenase Gene ORF cDNA clone in cloning vectorHG11650-M88420
휴먼 IDO1/Indoleamine 2,3‑dioxygenase Gene ORF cDNA clone expression plasmid, N-Flag 태그HG11650-NF229890
휴먼 IDO1/Indoleamine 2,3‑dioxygenase Gene ORF cDNA clone expression plasmid, N-His 태그HG11650-NH229890
휴먼 IDO1/Indoleamine 2,3‑dioxygenase Gene ORF cDNA clone expression plasmid, N-Myc 태그HG11650-NM229890
휴먼 IDO1/Indoleamine 2,3‑dioxygenase Gene ORF cDNA clone expression plasmid, N-HA 태그HG11650-NY229890
휴먼 IDO1/Indoleamine 2,3‑dioxygenase Gene ORF cDNA clone expression plasmidHG11650-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Indoleamine 2,3-dioxygenase-1, also known as Indoleamine-pyrrole 2,3-dioxygenase, IDO1 and IDO, is a member of the indoleamine 2,3-dioxygenase family. IDO1 / IDO and tryptophan 2,3-dioxygenase (TDO) are tryptophan-degrading enzymes that catalyze the first step in tryptophan catabolism via the kynurenine pathway. TDO is widely distributed in both eukaryotes and bacteria. In contrast, IDO has been found only in mammals and yeast. In 2007, a third enzyme, indoleamine 2,3-dioxygenase-2 (IDO2), was discovered. IDO2 is found not only in mammals but also in lower vertebrates. IDO1 / IDO is an immunosuppressive molecule inducible in various cells. IDO1 / IDO catalyzes the cleavage of the pyrrol ring of tryptophan and incorporates both atoms of a molecule of oxygen. It mediates oxidative cleavage of tryptophan, an amino acid essential for cell proliferation and survival. IDO1 / IDO inhibition is proposed to have therapeutic potential in immunodeficiency-associated abnormalities, including cancer. The IDO pathway is activated in multiple tumor types. Selective inhibition of IDO1 may represent an attractive cancer therapeutic strategy via up-regulation of cellular immunity. IDO1 / IDO is an enzyme that suppresses adaptive T-cell immunity by catabolizing tryptophan from the cellular microenvironment. Inhibition of IDO pathway might enhance the efficacy of immunotherapeutic strategies for cancer.

참고자료
  • Barnes NA. et al., 2009, J Immunol. 183 (9): 5768-77.
  • Yuasa HJ. et al., 2009, Comp Biochem Physiol B Biochem Mol Biol. 153 (2): 137-44.
  • L b S. et al., 2009, Cancer Immunol Immunother. 58 (1): 153-7.
  • Liu,X. et al., 2010, Blood.115 (17): 3520-30.
  • Sun,T. et al., 2010, Mol Cell Biochem. 342 (1-2): 29-34.
  • Kiank C. et al., 2010, PLoS One. 5 (7): e11825.
  • Size / Price
    Cat No: HG11650-CF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human IDO1 natural ORF mammalian expression plasmid, C-Flag tag
    • Human IDO1 ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".