After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Iduronate 2-Sulfatase / IDS transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Human IDS cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000202.5
cDNA 크기:1653bp
cDNA 설명:Full length Clone DNA of Homo sapiens iduronate 2-sulfatase, transcript variant 1 with C terminal Flag tag.
유전자 동의어:MPS2, SIDS
:Human
벡터:pCMV3-C-FLAG
Plasmid:pCMV3-IDS-Flag
제한 사이트:KpnI + XbaI (6kb + 1.69kb)
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human IDS Gene Plasmid Map
Human IDS / MPS2 transcript variant 1 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

휴먼 Iduronate 2-Sulfatase / IDS transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그 on other vectors
휴먼 Iduronate 2-Sulfatase / IDS transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10337-ACG288840
휴먼 Iduronate 2-Sulfatase / IDS transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10337-ACR288840
휴먼 Iduronate 2-Sulfatase / IDS transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10337-CF253472
휴먼 Iduronate 2-Sulfatase / IDS transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그HG10337-CH253472
휴먼 Iduronate 2-Sulfatase / IDS transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10337-CM253472
휴먼 Iduronate 2-Sulfatase / IDS transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG10337-CY253472
휴먼 Iduronate 2-Sulfatase / IDS transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10337-M88421
휴먼 Iduronate 2-Sulfatase / IDS transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10337-NF253472
휴먼 Iduronate 2-Sulfatase / IDS transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그HG10337-NH253472
휴먼 Iduronate 2-Sulfatase / IDS transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10337-NM253472
휴먼 Iduronate 2-Sulfatase / IDS transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG10337-NY253472
휴먼 Iduronate 2-Sulfatase / IDS transcript variant 1 Gene ORF cDNA clone expression plasmidHG10337-UT253472
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Iduronate 2-Sulfatase, also known as IDS, is a member of the highly conserved sulfatase family of enzymes that catalyze the hydrolysis of O- and N-sulfate esters from a variety of substrates. The human Iduronate 2-Sulfatase/IDS consists of a signal peptide, a pro peptide and a mature chain that may be further processed into two chains. Among the identified 18 human sulfatases, Iduronate 2-Sulfatase/IDS is required for the lysosomal degradation of the glycosaminoglycans (GAG), heparan sulfate and dermatan sulfate. Multiple mutations in this X-chromosome localized gene result in Iduronate 2-Sulfatase/IDS enzymatic deficiency, and lead to the sex-linked Mucopolysaccharidosis Type II (MPS II ), also known as Hunter Syndrome characterized by the lysosomal accumulation of the GAG and their excretion in urine. MPS II has a wide spectrum of clinical manifestations ranging from mild to severe due to the level of Iduronate 2-Sulfatase/IDS enzyme. Retroviral-mediated Iduronate 2-Sulfatase/IDS gene transfer into lymphoid cells would be a promising gene therapeutic strategy.

Size / Price
Cat No: HG10337-CF
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보In Stock
대량 주문 문의장바구니에 추가
Contact Us
이미지
  • Human IDS / MPS2 transcript variant 1 natural ORF mammalian expression plasmid, C-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".