After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

Human IFNα R2 transcript variant 1 ORF mammalian expression plasmid, C-Flag tag

데이터시트리뷰관련제품프로토콜
Human IFNAR2 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_207585.1
cDNA 크기:1548bp
cDNA 설명:Full length Clone DNA of Homo sapiens interferon (alpha, beta and omega) receptor 2, transcript variant 1 with C terminal Flag tag.
유전자 동의어:IFN-R, IFNABR, IFNARB, IFN-alpha-REC, IFNAR2
:Human
벡터:pCMV3-C-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Interferon-alpha/beta receptor beta chain (IFNAR2) is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. Initial cell-surface IFNAR2 expression at diagnosis assessed by flow cytometry widely distributed but showed overall significantly higher expression in CML patients when compared with normal controls. In 15 fresh patients who subsequently received IFNα therapy, IFNAR2 expression at diagnosis was significantly higher in cytogenetic good responders than in poor responders. Down-regulation of IFNAR2 expression during IFNα therapy was observed only in good responders but not in poor responders. The encoded protein also functions as an antiviral factor. IFNAR2 may associate with IFNAR1 to form the type I interferon receptor. This protein serves as a receptor for interferons alpha and beta. IFNAR2 is also involved in IFN-mediated STAT1, STAT2 and STAT3 activation. Isoform 1 and isoform 2 are directly involved in signal transduction due to their association with the TYR kinase, JAK1. Isoform 3 is a potent inhibitor of type I IFN receptor activity. Following binding of IFNα2, IFNAR2 is internalized, but, instead of being routed towards degradation as it is when complexed to IFNβ, it recycles back to the cell surface.

참고자료
  • Ito K, et al. (2004) Initial expression of interferon alpha receptor 2 (IFNAR2) on CD34-positive cells and its down-regulation correlate with clinical response to interferon therapy in chronic myelogenous leukemia. Eur J Haematol. 73(3): 191-205.
  • Kim SH, et al. (1997) Mammalian type I interferon receptors consists of two subunits: IFNaR1 and IFNaR2. Gene. 196(1-2): 279-86.
  • Saleh AZ, et al. (2004) Regulated proteolysis of the IFNaR2 subunit of the interferon-alpha receptor. Oncogene. 23(42): 7076-86.
  • Size / Price
    Cat No: HG10359-CF
    정가:   (Save )
    가격:      [How to order]
    재고정보
     배송안내
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".