휴먼 IGF2BP2/IMP2 Gene ORF cDNA clone expression plasmid, C-His 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 IGF2BP2 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_006548.4
    cDNA 크기:1800bp
    cDNA 설명:Full length Clone DNA of Homo sapiens insulin-like growth factor 2 mRNA binding protein 2 with C terminal His tag.
    유전자 동의어:p62, IMP2, IMP-2, VICKZ2
    :Human
    벡터:pCMV3-C-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IGF2BP2 qPCR primers for gene expression analysis, HP101030 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    연구배경

    Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) is a member of the IGF-II mRNA-binding protein (IMP) family. IGF2BP2 is a member of a family of mRNA binding proteins that, collectively, have been shown to bind to several different mRNAs in mammalian cells, including one of the mRNAs encoding insulin-like growth factor-2. Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) is involved in the stimulation of insulin action. IGF2BP2 / IMP2 is expressed in oocytes, granulosa cells of small and growing follicles, Leydig cells, spermatogonia and semen (at protein level). It is also expressed in testicular cancer (at protein level). It is expressed weakly in heart, placenta, skeletal muscle, bone marrow, colon, kidney, salivary glands, testis and pancreas. IGF2BP2 binds to the 5'-UTR of the insulin-like growth factor 2 (IGF2) mRNAs. This binding is isoform-specific. IGF2BP2 may regulate translation of target mRNAs.

    참고자료
  • Omori S, et al. (2008) Association of CDKAL1, IGF2BP2, CDKN2A/B, HHEX, SLC30A8, and KCNJ11 with susceptibility to type 2 diabetes in a Japanese population. Diabetes. 57(3): 791-5.
  • Grarup N, et al. (2007) Studies of association of variants near the HHEX, CDKN2A/B, and IGF2BP2 genes with type 2 diabetes and impaired insulin release in 10,705 Danish subjects: validation and extension of genome-wide association studies. Diabetes. 56(12): 3105-11.
  • Wu Y, et al. (2008) Common variants in CDKAL1, CDKN2A/B, IGF2BP2, SLC30A8, and HHEX/IDE genes are associated with type 2 diabetes and impaired fasting glucose in a Chinese Han population. Diabetes. 57(10): 2834-42.
  • Size / Price
    Cat No: HG11116-CH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".