IL17RB cDNA ORF Clone, Human, N-Myc tag

Cat: HG13091-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All IL17RB Reagents

CRO Services

Product recommended


All IL17RB Reagents

IL17RB cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1509 bp
Description
Full length Clone DNA of Human interleukin 17 receptor B with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL17RB cDNA ORF Clone, Human, N-Myc tag Alternative Names

CRL4 cDNA ORF Clone, Human;EVI27 cDNA ORF Clone, Human;IL17BR cDNA ORF Clone, Human;IL17RH1 cDNA ORF Clone, Human

IL17RB Background Information

Full Name
interleukin 17 receptor B
References
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Stock P, et al.. (2009) Induction of airway hyperreactivity by IL-25 is dependent on a subset of invariant NKT cells expressing IL-17RB. J Immunol. 182(8): 5116-22.
  • Wang H, et al.. (2010) Allergen challenge of peripheral blood mononuclear cells from patients with seasonal allergic rhinitis increases IL-17RB, which regulates basophil apoptosis and degranulation. Clin Exp Allergy. 40(8): 1194-202.
  • IL17RB cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL17RB cDNA ORF Clone in Cloning Vector, Rhesus CG90140-G
    IL17RB cDNA ORF Clone, Rhesus, untagged CG90140-UT
    IL17RB Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90140-ACGLN
    IL17RB cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90140-ACG
    IL17RB cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90140-ACR
    IL17RB cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90140-CF
    IL17RB cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90140-NF
    IL17RB cDNA ORF Clone, Rhesus, C-His tag CG90140-CH
    IL17RB cDNA ORF Clone, Rhesus, N-His tag CG90140-NH
    IL17RB cDNA ORF Clone, Rhesus, C-HA tag CG90140-CY
    IL17RB cDNA ORF Clone, Rhesus, N-HA tag CG90140-NY
    IL17RB cDNA ORF Clone, Rhesus, C-Myc tag CG90140-CM
    IL17RB cDNA ORF Clone, Rhesus, N-Myc tag CG90140-NM

    IL17RB cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL17RB cDNA ORF Clone in Cloning Vector, Rat RG80188-G
    IL17RB cDNA ORF Clone, Rat, untagged RG80188-UT
    IL17RB Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80188-ACGLN
    IL17RB cDNA ORF Clone, Rat, C-GFPSpark® tag RG80188-ACG
    IL17RB cDNA ORF Clone, Rat, C-OFPSpark® tag RG80188-ACR
    IL17RB cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80188-CF
    IL17RB cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80188-NF
    IL17RB cDNA ORF Clone, Rat, C-His tag RG80188-CH
    IL17RB cDNA ORF Clone, Rat, N-His tag RG80188-NH
    IL17RB cDNA ORF Clone, Rat, C-HA tag RG80188-CY
    IL17RB cDNA ORF Clone, Rat, N-HA tag RG80188-NY
    IL17RB cDNA ORF Clone, Rat, C-Myc tag RG80188-CM
    IL17RB cDNA ORF Clone, Rat, N-Myc tag RG80188-NM
    IL17RB qPCR Primer Pairs, Rat RP300180

    IL17RB cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL17RB cDNA ORF Clone in Cloning Vector, Mouse MG51109-G
    IL17RB cDNA ORF Clone, Mouse, untagged MG51109-UT
    IL17RB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51109-ACG
    IL17RB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51109-ACGLN
    IL17RB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51109-ACR
    IL17RB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51109-CF
    IL17RB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51109-NF
    IL17RB cDNA ORF Clone, Mouse, C-His tag MG51109-CH
    IL17RB cDNA ORF Clone, Mouse, N-His tag MG51109-NH
    IL17RB cDNA ORF Clone, Mouse, C-HA tag MG51109-CY
    IL17RB cDNA ORF Clone, Mouse, N-HA tag MG51109-NY
    IL17RB cDNA ORF Clone, Mouse, C-Myc tag MG51109-CM
    IL17RB cDNA ORF Clone, Mouse, N-Myc tag MG51109-NM
    IL17RB qPCR Primer Pairs, Mouse MP201061

    IL17RB cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL17RB cDNA ORF Clone in Cloning Vector, Human HG13091-M
    IL17RB cDNA ORF Clone, Human, untagged HG13091-UT
    IL17RB cDNA ORF Clone, Human, C-GFPSpark® tag HG13091-ACG
    IL17RB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13091-ACGLN
    IL17RB cDNA ORF Clone, Human, C-OFPSpark® tag HG13091-ACR
    IL17RB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13091-CF
    IL17RB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13091-NF
    IL17RB cDNA ORF Clone, Human, C-His tag HG13091-CH
    IL17RB cDNA ORF Clone, Human, N-His tag HG13091-NH
    IL17RB cDNA ORF Clone, Human, C-HA tag HG13091-CY
    IL17RB cDNA ORF Clone, Human, N-HA tag HG13091-NY
    IL17RB cDNA ORF Clone, Human, C-Myc tag HG13091-CM
    IL17RB qPCR Primer Pairs, Human HP100209
    info info
    添加购物车成功! 添加购物车失败!