IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10788-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All IL8Rb/CXCR2/CD182 Reagents

CRO Services

Product recommended


All IL8Rb/CXCR2/CD182 Reagents

IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1083 bp
Description
Full length Clone DNA of Human interleukin 8 receptor, beta with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, N-Myc tag Alternative Names

CD182 cDNA ORF Clone, Human;CDw128b cDNA ORF Clone, Human;CMKAR2 cDNA ORF Clone, Human;IL8R2 cDNA ORF Clone, Human;IL8RA cDNA ORF Clone, Human;IL8RB cDNA ORF Clone, Human

IL8Rb/CXCR2/CD182 Background Information

Full Name
chemokine (C-X-C motif) receptor 2

IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
IL8Rb/CXCR2/CD182 cDNA ORF Clone in Cloning Vector, Rhesus CG90118-G
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, untagged CG90118-UT
IL8Rb/CXCR2/CD182 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90118-ACGLN
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90118-ACG
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90118-ACR
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90118-CF
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90118-NF
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, C-His tag CG90118-CH
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, N-His tag CG90118-NH
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, C-HA tag CG90118-CY
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, N-HA tag CG90118-NY
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, C-Myc tag CG90118-CM
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rhesus, N-Myc tag CG90118-NM

IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IL8Rb/CXCR2/CD182 cDNA ORF Clone in Cloning Vector, Rat RG80199-G
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, untagged RG80199-UT
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80199-ACG
IL8Rb/CXCR2/CD182 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80199-ACGLN
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80199-ACR
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80199-CF
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80199-NF
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, C-His tag RG80199-CH
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, N-His tag RG80199-NH
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, C-HA tag RG80199-CY
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, N-HA tag RG80199-NY
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, C-Myc tag RG80199-CM
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Rat, N-Myc tag RG80199-NM
IL8Rb/CXCR2/CD182 qPCR Primer Pairs, Rat RP300191

IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IL8Rb/CXCR2/CD182 cDNA ORF Clone in Cloning Vector, Mouse MG50833-G
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, untagged MG50833-UT
IL8Rb/CXCR2/CD182 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50833-ACGLN
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50833-ACG
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50833-ACR
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50833-CF
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50833-NF
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, C-His tag MG50833-CH
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, N-His tag MG50833-NH
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, C-HA tag MG50833-CY
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, N-HA tag MG50833-NY
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, C-Myc tag MG50833-CM
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Mouse, N-Myc tag MG50833-NM
IL8Rb/CXCR2/CD182 qPCR Primer Pairs, Mouse MP200804

IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IL8Rb/CXCR2/CD182 cDNA ORF Clone in Cloning Vector, Human HG10788-M
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, untagged HG10788-UT
IL8Rb/CXCR2/CD182 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10788-ACGLN
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, C-GFPSpark® tag HG10788-ACG
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, N-GFPSpark® tag HG10788-ANG
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, C-OFPSpark® tag HG10788-ACR
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10788-CF
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10788-NF
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, C-His tag HG10788-CH
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, N-His tag HG10788-NH
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, C-HA tag HG10788-CY
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, N-HA tag HG10788-NY
IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, C-Myc tag HG10788-CM
IL8Rb/CXCR2/CD182 qPCR Primer Pairs, Human HP100702
info info
添加购物车成功! 添加购物车失败!