After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 Jagged 1/JAG1/CD339 Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Human JAG1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000214.2
cDNA 크기:3645bp
cDNA 설명:Full length Clone DNA of Homo sapiens collagen triple helix repeat containing 1 with C terminal Flag tag.
유전자 동의어:AGS, AHD, AWS, HJ1, CD339, JAGL1, MGC104644, JAG1
:Human
벡터:pCMV3-C-FLAG
Plasmid:pCMV3-JAG1-Flag
제한 사이트:HindIII + XbaI (6kb + 3.7kb)
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 402 G/A, 2526 C/T and 3417 T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human JAG1 Gene Plasmid Map
Human JAG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Human JAG1 Gene Expression validated Image
Human JAG1 natural ORF mammalian expression plasmid, C-Flag tag
[이미지를 확대하려면 클릭]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Protein Jagged 1, also known as JAG1, JAGL1 and CD339, is a single-pass type I  membrane protein which contains 1 DSL domain and 15 EGF-like domains. JAG1/Jagged 1 is widely expressed in adult and fetal tissues. The expression of JAG1/Jagged 1 is up-regulated in cervical squamous cell carcinoma. JAG1/Jagged 1 is also expressed in bone marrow cell line HS-27a which supports the long-term maintenance of immature progenitor cells. JAG1/Jagged 1 is a ligand for multiple Notch receptors. It is involved in the mediation of Notch signaling. JAG1/Jagged 1 may be involved in cell-fate decisions during hematopoiesis. 

JAG1/Jagged 1 seems to be involved in early and late stages of mammalian cardiovascular development. It inhibits myoblast differentiation and enhances fibroblast growth factor-induced angiogenesis. Defects in JAG1/Jagged 1 are the cause of Alagille syndrome type 1 (ALGS1). Alagille syndrome is an autosomal dominant multisystem disorder defined clinically by hepatic bile duct paucity and cholestasis in association with cardiac, skeletal, and ophthalmologic manifestations. Defects in JAG1/Jagged 1 are also a cause of tetralogy of Fallot (TOF). TOF is a congenital heart anomaly which consists of pulmonary stenosis, ventricular septal defect, dextroposition of the aorta (aorta is on the right side instead of the left) and hypertrophy of the right ventricle. This condition results in a blue baby at birth due to inadequate oxygenation.

참고자료
  1. Oda T.et al., 1997, Nat. Genet. 16:235-242.
  2. Krantz I.D. et al., 1998, Am. J. Hum. Genet. 62:1361-1369.
  3. Li L. et al., 1998, Immunity. 8:43-55.
  4. Jones E.A. et al., 2000, J. Med. Genet. 37: 658-662.
  5. Roepke A.et al., 2003, Hum. Mutat. 21:100-100.
  6. Jurkiewicz D.et al., 2005, Hum. Mutat. 25:321-321.
  7. Warthen D.M.et al., 2006, Hum. Mutat. 27:436-443.
Size / Price
Cat No: HG11648-CF
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보In Stock
대량 주문 문의장바구니에 추가
Contact Us
이미지
  • Human JAG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
  • Human JAG1 natural ORF mammalian expression plasmid, C-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".