Jagged 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11648-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Jagged 1 Reagents
CRO Services
Product recommended

All Jagged 1 Reagents
Jagged 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3645 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 402 G/A, 2526 C/T and 3417 T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human collagen triple helix repeat containing 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
HindIII + XbaI (6kb + 3.7kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Jagged 1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Jagged 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human Jagged 1/JAG1/CD339 Gene Expression validated Image 1837
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5619
Jagged 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
AGS cDNA ORF Clone, Human;AHD cDNA ORF Clone, Human;AWS cDNA ORF Clone, Human;CD339 cDNA ORF Clone, Human;HJ1 cDNA ORF Clone, Human;Jagged 1 cDNA ORF Clone, Human;JAGL1 cDNA ORF Clone, Human
Jagged 1 Background Information

Protein Jagged 1, also known as JAG1, JAGL1 and CD339, is a single-pass type I  membrane protein which contains 1 DSL domain and 15 EGF-like domains. JAG1/Jagged 1 is widely expressed in adult and fetal tissues. The expression of JAG1/Jagged 1 is up-regulated in cervical squamous cell carcinoma. JAG1/Jagged 1 is also expressed in bone marrow cell line HS-27a which supports the long-term maintenance of immature progenitor cells. JAG1/Jagged 1 is a ligand for multiple Notch receptors. It is involved in the mediation of Notch signaling. JAG1/Jagged 1 may be involved in cell-fate decisions during hematopoiesis. 

JAG1/Jagged 1 seems to be involved in early and late stages of mammalian cardiovascular development. It inhibits myoblast differentiation and enhances fibroblast growth factor-induced angiogenesis. Defects in JAG1/Jagged 1 are the cause of Alagille syndrome type 1 (ALGS1). Alagille syndrome is an autosomal dominant multisystem disorder defined clinically by hepatic bile duct paucity and cholestasis in association with cardiac, skeletal, and ophthalmologic manifestations. Defects in JAG1/Jagged 1 are also a cause of tetralogy of Fallot (TOF). TOF is a congenital heart anomaly which consists of pulmonary stenosis, ventricular septal defect, dextroposition of the aorta (aorta is on the right side instead of the left) and hypertrophy of the right ventricle. This condition results in a blue baby at birth due to inadequate oxygenation.

Full Name
jagged 1
References
  • Oda T.et al., 1997, Nat. Genet. 16:235-242.
  • Krantz I.D. et al., 1998, Am. J. Hum. Genet. 62:1361-1369.
  • Li L. et al., 1998, Immunity. 8:43-55.
  • Jones E.A. et al., 2000, J. Med. Genet. 37: 658-662.
  • Roepke A.et al., 2003, Hum. Mutat. 21:100-100.
  • Jurkiewicz D.et al., 2005, Hum. Mutat. 25:321-321.
  • Warthen D.M.et al., 2006, Hum. Mutat. 27:436-443.
  • Jagged 1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Jagged 1 cDNA ORF Clone in Cloning Vector, Rat RG80419-G
    Jagged 1 cDNA ORF Clone, Rat, untagged RG80419-UT
    Jagged 1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80419-ACG
    Jagged 1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80419-ACGLN
    Jagged 1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80419-ACR
    Jagged 1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80419-CF
    Jagged 1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80419-NF
    Jagged 1 cDNA ORF Clone, Rat, C-His tag RG80419-CH
    Jagged 1 cDNA ORF Clone, Rat, N-His tag RG80419-NH
    Jagged 1 cDNA ORF Clone, Rat, C-HA tag RG80419-CY
    Jagged 1 cDNA ORF Clone, Rat, N-HA tag RG80419-NY
    Jagged 1 cDNA ORF Clone, Rat, C-Myc tag RG80419-CM
    Jagged 1 cDNA ORF Clone, Rat, N-Myc tag RG80419-NM
    Jagged 1 qPCR Primer Pairs, Rat RP300383

    Jagged 1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Jagged 1 cDNA ORF Clone in Cloning Vector, Mouse MG57140-G
    Jagged 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57140-ACGLN

    Jagged 1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Jagged 1 cDNA ORF Clone in Cloning Vector, Human HG11648-M
    Jagged 1 cDNA ORF Clone, Human, untagged HG11648-UT
    Jagged 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11648-ACGLN
    Jagged 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11648-ACG
    Jagged 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11648-ACR
    Jagged 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11648-NF
    Jagged 1 cDNA ORF Clone, Human, C-His tag HG11648-CH
    Jagged 1 cDNA ORF Clone, Human, N-His tag HG11648-NH
    Jagged 1 cDNA ORF Clone, Human, C-HA tag HG11648-CY
    Jagged 1 cDNA ORF Clone, Human, N-HA tag HG11648-NY
    Jagged 1 cDNA ORF Clone, Human, C-Myc tag HG11648-CM
    Jagged 1 cDNA ORF Clone, Human, N-Myc tag HG11648-NM
    Jagged 1 qPCR Primer Pairs, Human HP100081
    info info
    添加购物车成功! 添加购物车失败!