KATNA1/Katanin p60 cDNA ORF Clone, Human, C-HA tag

Cat: HG15168-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All KATNA1/Katanin p60 Reagents

CRO Services

Product recommended


All KATNA1/Katanin p60 Reagents

KATNA1/Katanin p60 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
936 bp
Description
Full length Clone DNA of Human katanin p60 (ATPase containing) subunit A 1 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KATNA1/Katanin p60 Background Information

Full Name
katanin p60 (ATPase containing) subunit A 1

KATNA1/Katanin p60 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KATNA1/Katanin p60 cDNA ORF Clone in Cloning Vector, Mouse MG5A0948-U
KATNA1/Katanin p60 cDNA ORF Clone, Mouse, untagged MG5A0948-UT
KATNA1/Katanin p60 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0948-ACGLN
KATNA1/Katanin p60 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0948-ACG
KATNA1/Katanin p60 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0948-ANG
KATNA1/Katanin p60 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0948-ACR
KATNA1/Katanin p60 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0948-ANR
KATNA1/Katanin p60 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0948-CF
KATNA1/Katanin p60 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0948-NF
KATNA1/Katanin p60 cDNA ORF Clone, Mouse, C-His tag MG5A0948-CH
KATNA1/Katanin p60 cDNA ORF Clone, Mouse, N-His tag MG5A0948-NH
KATNA1/Katanin p60 cDNA ORF Clone, Mouse, C-HA tag MG5A0948-CY
KATNA1/Katanin p60 cDNA ORF Clone, Mouse, N-HA tag MG5A0948-NY
KATNA1/Katanin p60 cDNA ORF Clone, Mouse, C-Myc tag MG5A0948-CM
KATNA1/Katanin p60 cDNA ORF Clone, Mouse, N-Myc tag MG5A0948-NM

KATNA1/Katanin p60 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KATNA1/Katanin p60 cDNA ORF Clone in Cloning Vector, Human HG15168-G
KATNA1/Katanin p60 cDNA ORF Clone, Human, untagged HG15168-UT
KATNA1/Katanin p60 cDNA ORF Clone, Human, C-GFPSpark® tag HG15168-ACG
KATNA1/Katanin p60 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15168-ACGLN
KATNA1/Katanin p60 cDNA ORF Clone, Human, N-GFPSpark® tag HG15168-ANG
KATNA1/Katanin p60 cDNA ORF Clone, Human, C-OFPSpark® tag HG15168-ACR
KATNA1/Katanin p60 cDNA ORF Clone, Human, N-OFPSpark® tag HG15168-ANR
KATNA1/Katanin p60 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15168-CF
KATNA1/Katanin p60 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15168-NF
KATNA1/Katanin p60 cDNA ORF Clone, Human, C-His tag HG15168-CH
KATNA1/Katanin p60 cDNA ORF Clone, Human, N-His tag HG15168-NH
KATNA1/Katanin p60 cDNA ORF Clone, Human, N-HA tag HG15168-NY
KATNA1/Katanin p60 cDNA ORF Clone, Human, C-Myc tag HG15168-CM
KATNA1/Katanin p60 cDNA ORF Clone, Human, N-Myc tag HG15168-NM
KATNA1/Katanin p60 qPCR Primer Pairs, Human HP103795
info info
添加购物车成功! 添加购物车失败!