KHDRBS3 cDNA ORF Clone, Human, N-HA tag

Cat: HG14033-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All KHDRBS3 Reagents

CRO Services

Product recommended


All KHDRBS3 Reagents

KHDRBS3 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1041 bp
Description
Full length Clone DNA of Human KH domain containing, RNA binding, signal transduction associated 3 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KHDRBS3 cDNA ORF Clone, Human, N-HA tag Alternative Names

Etle cDNA ORF Clone, Human;etoile cDNA ORF Clone, Human;SALP cDNA ORF Clone, Human;SLM-2 cDNA ORF Clone, Human;SLM2 cDNA ORF Clone, Human;T-STAR cDNA ORF Clone, Human;TSTAR cDNA ORF Clone, Human

KHDRBS3 Background Information

Full Name
KH domain containing, RNA binding, signal transduction associated 3

KHDRBS3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KHDRBS3 cDNA ORF Clone in Cloning Vector, Mouse MG52695-G
KHDRBS3 cDNA ORF Clone, Mouse, untagged MG52695-UT
KHDRBS3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52695-ACG
KHDRBS3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52695-ACGLN
KHDRBS3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52695-ANG
KHDRBS3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52695-ACR
KHDRBS3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52695-ANR
KHDRBS3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52695-CF
KHDRBS3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52695-NF
KHDRBS3 cDNA ORF Clone, Mouse, C-His tag MG52695-CH
KHDRBS3 cDNA ORF Clone, Mouse, N-His tag MG52695-NH
KHDRBS3 cDNA ORF Clone, Mouse, C-HA tag MG52695-CY
KHDRBS3 cDNA ORF Clone, Mouse, N-HA tag MG52695-NY
KHDRBS3 cDNA ORF Clone, Mouse, C-Myc tag MG52695-CM
KHDRBS3 cDNA ORF Clone, Mouse, N-Myc tag MG52695-NM
KHDRBS3 qPCR Primer Pairs, Mouse MP202566

KHDRBS3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KHDRBS3 cDNA ORF Clone in Cloning Vector, Human HG14033-G
KHDRBS3 cDNA ORF Clone, Human, untagged HG14033-UT
KHDRBS3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14033-ACG
KHDRBS3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14033-ACGLN
KHDRBS3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14033-ANG
KHDRBS3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14033-ACR
KHDRBS3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14033-ANR
KHDRBS3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14033-CF
KHDRBS3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14033-NF
KHDRBS3 cDNA ORF Clone, Human, C-His tag HG14033-CH
KHDRBS3 cDNA ORF Clone, Human, N-His tag HG14033-NH
KHDRBS3 cDNA ORF Clone, Human, C-HA tag HG14033-CY
KHDRBS3 cDNA ORF Clone, Human, C-Myc tag HG14033-CM
KHDRBS3 cDNA ORF Clone, Human, N-Myc tag HG14033-NM
KHDRBS3 qPCR Primer Pairs, Human HP102689
info info
添加购物车成功! 添加购物车失败!