Ketohexokinase/KHK cDNA ORF Clone, Human, C-His tag

Cat: HG16336-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Ketohexokinase/KHK Reagents

CRO Services

Product recommended


All Ketohexokinase/KHK Reagents

Ketohexokinase/KHK cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
897 bp
Description
Full length Clone DNA of Human ketohexokinase (fructokinase) with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ketohexokinase/KHK Background Information

Full Name
ketohexokinase

Ketohexokinase/KHK cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Ketohexokinase/KHK cDNA ORF Clone in Cloning Vector, Mouse MG52981-G
Ketohexokinase/KHK cDNA ORF Clone, Mouse, untagged MG52981-UT
Ketohexokinase/KHK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52981-ACGLN
Ketohexokinase/KHK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52981-ACG
Ketohexokinase/KHK cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52981-ANG
Ketohexokinase/KHK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52981-ACR
Ketohexokinase/KHK cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52981-ANR
Ketohexokinase/KHK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52981-CF
Ketohexokinase/KHK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52981-NF
Ketohexokinase/KHK cDNA ORF Clone, Mouse, C-His tag MG52981-CH
Ketohexokinase/KHK cDNA ORF Clone, Mouse, N-His tag MG52981-NH
Ketohexokinase/KHK cDNA ORF Clone, Mouse, C-HA tag MG52981-CY
Ketohexokinase/KHK cDNA ORF Clone, Mouse, N-HA tag MG52981-NY
Ketohexokinase/KHK cDNA ORF Clone, Mouse, C-Myc tag MG52981-CM
Ketohexokinase/KHK cDNA ORF Clone, Mouse, N-Myc tag MG52981-NM

Ketohexokinase/KHK cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Ketohexokinase/KHK cDNA ORF Clone in Cloning Vector, Human HG16336-G
Ketohexokinase/KHK cDNA ORF Clone, Human, untagged HG16336-UT
Ketohexokinase/KHK cDNA ORF Clone, Human, C-GFPSpark® tag HG16336-ACG
Ketohexokinase/KHK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16336-ACGLN
Ketohexokinase/KHK cDNA ORF Clone, Human, N-GFPSpark® tag HG16336-ANG
Ketohexokinase/KHK cDNA ORF Clone, Human, C-OFPSpark® tag HG16336-ACR
Ketohexokinase/KHK cDNA ORF Clone, Human, N-OFPSpark® tag HG16336-ANR
Ketohexokinase/KHK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16336-CF
Ketohexokinase/KHK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16336-NF
Ketohexokinase/KHK cDNA ORF Clone, Human, N-His tag HG16336-NH
Ketohexokinase/KHK cDNA ORF Clone, Human, C-HA tag HG16336-CY
Ketohexokinase/KHK cDNA ORF Clone, Human, N-HA tag HG16336-NY
Ketohexokinase/KHK cDNA ORF Clone, Human, C-Myc tag HG16336-CM
Ketohexokinase/KHK cDNA ORF Clone, Human, N-Myc tag HG16336-NM
Ketohexokinase/KHK qPCR Primer Pairs, Human HP105089
info info
添加购物车成功! 添加购物车失败!