휴먼 KIR2DL3 (CD158b2) Gene ORF cDNA clone expression plasmid, N-His 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 KIR2DL3 cDNA 클론 제품 정보
    Gene_bank_ref_id:BC032422
    cDNA 크기:1026bp
    cDNA 설명:Full length Clone DNA of Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3 with N terminal His tag.
    유전자 동의어:p58, NKAT, GL183, NKAT2, CD158b, NKAT2A, NKAT2B, CD158B2, KIR-K7b, KIR-K7c, KIRCL23, KIR-023GB
    :Human
    벡터:pCMV3-SP-N-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with KIR2DL3 qPCR primers for gene expression analysis, HP102117 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    연구배경

    Killer cell immunoglobulin-like receptor 2DL3, also known as CD158 antigen-like family member B2, KIR-023GB, Killer inhibitory receptor cl 2-3, MHC class I NK cell receptor, NKAT2a, NKAT2b, Natural killer-associated transcript 2, p58 natural killer cell receptor clone CL-6, p58.2 MHC class-I-specific NK receptor, CD158b2 and KIR2DL3, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. KIR2DL3 contains 2 Ig-like C2-type (immunoglobulin-like) domains. KIR2DL3 interacts with ARRB2. KIR2DL3 is a receptor on natural killer (NK) cells for HLA-C alleles (HLA-Cw1, HLA-Cw3 and HLA-Cw7). KIR2DL3 inhibits the activity of NK cells thus preventing cell lysis.

    참고자료
  • Selvakumar A., et al., 1997, Immunol. Rev. 155:183-196.
  • Wilson M.J., et al., 1997, Tissue Antigens 49:574-579.
  • Maenaka K., et al., 1999, Structure 7:391-398.
  • Vitale,M. et al., 2004, Int Immunol. 16 (10):1459-66.
  • Yu M.-C., et al., 2008, Nat. Immunol. 9:898-907.
  • Size / Price
    Cat No: HG12828-NH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".