After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 KIR2DL3 (CD158b2) Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human KIR2DL3 cDNA 클론 제품 정보
Gene_bank_ref_id:BC032422
cDNA 크기:1026bp
cDNA 설명:Full length Clone DNA of Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3 with N terminal His tag.
유전자 동의어:p58, NKAT, GL183, NKAT2, CD158b, NKAT2A, NKAT2B, CD158B2, KIR-K7b, KIR-K7c, KIRCL23, KIR-023GB
:Human
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

Killer cell immunoglobulin-like receptor 2DL3, also known as CD158 antigen-like family member B2, KIR-023GB, Killer inhibitory receptor cl 2-3, MHC class I NK cell receptor, NKAT2a, NKAT2b, Natural killer-associated transcript 2, p58 natural killer cell receptor clone CL-6, p58.2 MHC class-I-specific NK receptor, CD158b2 and KIR2DL3, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. KIR2DL3 contains 2 Ig-like C2-type (immunoglobulin-like) domains. KIR2DL3 interacts with ARRB2. KIR2DL3 is a receptor on natural killer (NK) cells for HLA-C alleles (HLA-Cw1, HLA-Cw3 and HLA-Cw7). KIR2DL3 inhibits the activity of NK cells thus preventing cell lysis.

참고자료
  • Selvakumar A., et al., 1997, Immunol. Rev. 155:183-196.
  • Wilson M.J., et al., 1997, Tissue Antigens 49:574-579.
  • Maenaka K., et al., 1999, Structure 7:391-398.
  • Vitale,M. et al., 2004, Int Immunol. 16 (10):1459-66.
  • Yu M.-C., et al., 2008, Nat. Immunol. 9:898-907.
  • Size / Price
    Cat No: HG12828-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".