KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-Myc tag

Cat: HG12174-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All KRT6A/Cytokeratin6A Reagents

CRO Services

Product recommended


All KRT6A/Cytokeratin6A Reagents

KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1695 bp
Description
Full length Clone DNA of Human keratin 6A with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-Myc tag Alternative Names

CK6A cDNA ORF Clone, Human;CK6C cDNA ORF Clone, Human;CK6D cDNA ORF Clone, Human;K6A cDNA ORF Clone, Human;K6C cDNA ORF Clone, Human;K6D cDNA ORF Clone, Human;KRT6C cDNA ORF Clone, Human;KRT6D cDNA ORF Clone, Human;PC3 cDNA ORF Clone, Human

KRT6A/Cytokeratin6A Background Information

Full Name
keratin 6A, type II

KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KRT6A/Cytokeratin6A cDNA ORF Clone in Cloning Vector, Mouse MG52935-G
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, untagged MG52935-UT
KRT6A/Cytokeratin6A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52935-ACGLN
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52935-ACG
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52935-ACR
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52935-CF
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52935-NF
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, C-His tag MG52935-CH
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, N-His tag MG52935-NH
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, C-HA tag MG52935-CY
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, N-HA tag MG52935-NY
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, C-Myc tag MG52935-CM
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, N-Myc tag MG52935-NM

KRT6A/Cytokeratin6A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KRT6A/Cytokeratin6A cDNA ORF Clone in Cloning Vector, Human HG13196-G
KRT6A/Cytokeratin6A cDNA ORF Clone in Cloning Vector, Human HG12174-G
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, untagged HG12174-UT
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, untagged HG13196-UT
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-GFPSpark® tag HG12174-ACG
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-GFPSpark® tag HG13196-ACG
KRT6A/Cytokeratin6A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12174-ACGLN
KRT6A/Cytokeratin6A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13196-ACGLN
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-GFPSpark® tag HG12174-ANG
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-GFPSpark® tag HG13196-ANG
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-OFPSpark® tag HG12174-ACR
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-OFPSpark® tag HG13196-ACR
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-OFPSpark® tag HG12174-ANR
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-OFPSpark® tag HG13196-ANR
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13196-CF
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12174-CF
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12174-NF
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13196-NF
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-His tag HG12174-CH
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-His tag HG13196-CH
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-His tag HG13196-NH
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-His tag HG12174-NH
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-HA tag HG13196-CY
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-HA tag HG12174-CY
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-HA tag HG12174-NY
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-HA tag HG13196-NY
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-Myc tag HG13196-CM
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-Myc tag HG12174-NM
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-Myc tag HG13196-NM
KRT6A/Cytokeratin6A qPCR Primer Pairs, Human HP101775
info info
添加购物车成功! 添加购物车失败!