After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Lipopolysaccharide binding 단백질/LBP Gene ORF cDNA clone expression plasmid, N-HA 태그

데이터시트리뷰관련제품프로토콜
Human LBP cDNA 클론 제품 정보
Gene_bank_ref_id:NM_004139.2
cDNA 크기:1446bp
cDNA 설명:Full length Clone DNA of Homo sapiens lipopolysaccharide binding protein with N terminal HA tag.
유전자 동의어:MGC22233
:Human
벡터:pCMV3-SP-N-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

휴먼 Lipopolysaccharide binding 단백질/LBP Gene ORF cDNA clone expression plasmid, N-HA 태그 on other vectors
휴먼 Lipopolysaccharide binding 단백질/LBP Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10526-ACG265260
휴먼 Lipopolysaccharide binding 단백질/LBP Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10526-ACR265260
휴먼 Lipopolysaccharide binding 단백질/LBP Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10526-CF229890
휴먼 Lipopolysaccharide binding 단백질/LBP Gene ORF cDNA clone expression plasmid, C-His 태그HG10526-CH229890
휴먼 Lipopolysaccharide binding 단백질/LBP Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10526-CM229890
휴먼 Lipopolysaccharide binding 단백질/LBP Gene ORF cDNA clone expression plasmid, C-HA 태그HG10526-CY229890
휴먼 Lipopolysaccharide binding 단백질/LBP Gene ORF cDNA clone in cloning vectorHG10526-M88420
휴먼 Lipopolysaccharide binding 단백질/LBP Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10526-M-F229890
휴먼 Lipopolysaccharide binding 단백질/LBP Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10526-NF229890
휴먼 Lipopolysaccharide binding 단백질/LBP Gene ORF cDNA clone expression plasmid, N-His 태그HG10526-NH229890
휴먼 Lipopolysaccharide binding 단백질/LBP Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10526-NM229890
휴먼 Lipopolysaccharide binding 단백질/LBP Gene ORF cDNA clone expression plasmid, N-HA 태그HG10526-NY229890
휴먼 Lipopolysaccharide binding 단백질/LBP Gene ORF cDNA clone expression plasmidHG10526-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Lipopolysaccharide binding protein ( LBP ) is a glycoprotein that is synthesized principally by hepatocytes. LBP is a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides ( LPSs ). LBP binds directly to the outer membrane of Gram-negative bacteria and to purified aggregates of extracted endotoxin, and catalyses the delivery of endotoxin to membrane ( mCD14,GPI-Linked ) and soluble ( sCD14 ) forms of CD14, thereby markedly increasing host cell sensitivity to endotoxin. LBP efficiently catalyses the transfer of individual molecules of endotoxin to (s)CD14 only when LBP–endotoxin aggregates are formed in the presence of albumin. In the presence of EDTA, LBP binding promotes further disaggregation of endotoxin. LBP binding does not have such drastic effects under more physiological conditions, but may still induce more subtle topological rearrangements of endotoxin.

참고자료
  • J. Weiss, 2003, Biochemical Society Transactions: Volume 31, part 4: 785-790.
  • RR Schumann, et al., Science, 1990, Vol 249, Issue 4975: 1429-143.
  • Carsten J. Kirschning, et al., 1997, Genomics, Volume 46, Issue 3: 416-25.
  • Size / Price
    Cat No: HG10526-NY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".