C18orf1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13730-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All C18orf1 Reagents

CRO Services

Product recommended


All C18orf1 Reagents

C18orf1 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
690 bp
Description
Full length Clone DNA of Human low density lipoprotein receptor class A domain containing 4 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About C18orf1

Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C18orf1 cDNA ORF Clone, Human, N-Myc tag Alternative Names

C18orf1 cDNA ORF Clone, Human

C18orf1 Background Information

Full Name
low density lipoprotein receptor class A domain containing 4

C18orf1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
C18orf1 cDNA ORF Clone in Cloning Vector, Human HG21626-U
C18orf1 cDNA ORF Clone in Cloning Vector, Human HG13730-G
C18orf1 cDNA ORF Clone, Human, untagged HG21626-UT
C18orf1 cDNA ORF Clone, Human, untagged HG13730-UT
C18orf1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21626-ACGLN
C18orf1 cDNA ORF Clone, Human, C-GFPSpark® tag HG21626-ACG
C18orf1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13730-ACGLN
C18orf1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13730-ACG
C18orf1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13730-ACR
C18orf1 cDNA ORF Clone, Human, C-OFPSpark® tag HG21626-ACR
C18orf1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21626-CF
C18orf1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13730-CF
C18orf1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13730-NF
C18orf1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21626-NF
C18orf1 cDNA ORF Clone, Human, C-His tag HG21626-CH
C18orf1 cDNA ORF Clone, Human, C-His tag HG13730-CH
C18orf1 cDNA ORF Clone, Human, N-His tag HG13730-NH
C18orf1 cDNA ORF Clone, Human, N-His tag HG21626-NH
C18orf1 cDNA ORF Clone, Human, C-HA tag HG13730-CY
C18orf1 cDNA ORF Clone, Human, C-HA tag HG21626-CY
C18orf1 cDNA ORF Clone, Human, N-HA tag HG13730-NY
C18orf1 cDNA ORF Clone, Human, N-HA tag HG21626-NY
C18orf1 cDNA ORF Clone, Human, C-Myc tag HG21626-CM
C18orf1 cDNA ORF Clone, Human, C-Myc tag HG13730-CM
C18orf1 cDNA ORF Clone, Human, N-Myc tag HG21626-NM
C18orf1 qPCR Primer Pairs, Human HP102407
info info
添加购物车成功! 添加购物车失败!