휴먼 Leukemia Inhibitory Factor/LIF Gene ORF cDNA clone expression plasmid, N-Myc 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 LIF cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_002309.4
    cDNA 크기:609bp
    cDNA 설명:Full length Clone DNA of Homo sapiens leukemia inhibitory factor with N terminal Myc tag.
    유전자 동의어:CDF, DIA, HILDA, MLPLI
    :Human
    벡터:pCMV3-SP-N-Myc
    Plasmid:
    제한 사이트:
    태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LIF qPCR primers for gene expression analysis, HP103197 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    연구배경

    Leukemia inhibitory factor (LIF) is a pleiotropic glycoprotein belonging to the IL-6 family of cytokines. It’s involved in growth promotion and cell differentiation of different types of target cells, influence on bone metabolism, cachexia, neural development, embryogenesis and inflammation. LIF has potent proinflammatory property, being the inducer of the acute phase protein synthesis and affecting the cell recruitment into the area of damage or inflammation. LIF is also one of the cytokines that are capable to regulate the differentiation of embryonic stem cells, hematopoietic and neuronal cells. LIF binds to the specific LIF receptor (LIFR-α) which forms a heterodimer with a specific subunit common to all members of that family of receptors, the GP130 signal transducing subunit. This leads to activation of the JAK/STAT and MAPK cascades. Due to its polyfunctional activities, LIF is involved in the pathogenic events and development of many diseases of various origin.

    참고자료
  • Salas EM, et al. (2011) LIF, a Novel STAT5-Regulated Gene, Is Aberrantly Expressed in Myeloproliferative Neoplasms. Genes Cancer. 2 (5): 593-6.
  • Chodorowska G, et al. (2004) Leukemia inhibitory factor (LIF) and its biological activity. Ann Univ Mariae Curie Sklodowska Med. 59 (2): 189-93.
  • Garcia-Campana AM, et al. (2007) LIF detection of peptides and proteins in CE. Electrophoresis. 28 (1-2): 208-32.
  • Size / Price
    Cat No: HG14890-NM
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".