휴먼 LIPG Gene ORF cDNA clone expression plasmid, N-Myc 태그

데이터시트리뷰관련제품프로토콜
휴먼 LIPG cDNA 클론 제품 정보
Gene_bank_ref_id:BC060825
cDNA 크기:1503bp
cDNA 설명:Full length Clone DNA of Homo sapiens lipase, endothelial with N terminal Myc tag.
유전자 동의어:EL, EDL, PRO719, LIPG
:Human
벡터:pCMV3-SP-N-Myc
Plasmid:pCMV3-Myc-LIPG
제한 사이트:KpnI + XbaI (6kb + 1.54kb)
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with LIPG qPCR primers for gene expression analysis, HP102411 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
휴먼 LIPG Gene Plasmid Map
Human LIPG ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Size / Price
Cat No: HG13734-NM
정가: 
가격:      (You Save: )
Contact Us
이미지
  • Human LIPG ORF mammalian expression plasmid, N-Myc tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".