After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 LOXL3 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human LOXL3 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_032603
cDNA 크기:2262bp
cDNA 설명:Full length Clone DNA of Homo sapiens lysyl oxidase-like 3.
유전자 동의어:LOXL3, LOXL3
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-LOXL3
제한 사이트:KpnI + XbaI (6.1kb + 2.26kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Cat No: HG12027-UT
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보In Stock
대량 주문 문의장바구니에 추가
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".