After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 LRRTM4 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human LRRTM4 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001134745.1
cDNA 크기:1773bp
cDNA 설명:Full length Clone DNA of Homo sapiens leucine rich repeat transmembrane neuronal 4 with N terminal His tag.
유전자 동의어:FLJ12568, MGC120633, MGC120636, LRRTM4
:Human
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

Leucine-rich repeat transmembrane neuronal protein 4, also known as LRRTM4, is a single-pass type I  membrane protein which belongs to the LRRTM family. LRRTM4 is expressed in the limb mesenchyme, neural tube, caudal mesoderm and in three distinct regions of the head. LRRTM4 may play a role in the development and maintenance of the vertebrate nervous system. Leucine-rich repeat containing proteins are involved in protein-protein interactions and they regulate numerous cellular events during nervous system development and disease. Human and mouse LRRTMs are highly conserved, and orthologous genes exist in other vertebrates but not in invertebrates. LRRTM mRNAs are predominantly expressed in the nervous system and that each LRRTM possesses a specific, partially nonoverlapping expression pattern. The structure and expression profile of LRRTM mRNAs suggest that they may have a role in the development and maintenance of the vertebrate nervous system. All LRRTMs, except LRRTM4, are located in the introns of different alpha-catenin genes, suggesting coevolution of these two gene families.

참고자료
  • Laurén,J. et al., 2003, Genomics 81 (4):411-21.
  • Clark HF. et al.,2003, Genome Res. 13: 2265-70.
  • Haines,BP. et al., 2007,Gene Expr Patterns  7 (1-2): 23-9.
  • Size / Price
    Cat No: HG11387-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".