After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Lysozyme 2 / LYZL2 Gene ORF cDNA clone expression plasmid, N-Myc 태그

데이터시트리뷰관련제품프로토콜
Human LYZL2 cDNA 클론 제품 정보
Gene_bank_ref_id:BC066294
cDNA 크기:585bp
cDNA 설명:Full length Clone DNA of Homo sapiens lysozyme-like 2 with N terminal Myc tag.
유전자 동의어:LYZL2
:Human
벡터:pCMV3-SP-N-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
연구배경

Lysozyme 2 gene is a member of a family of lysozyme-like genes. Lysozymes, especially C-type lysozymes, are well-recognized bacteriolytic factors widely distributed in the animal kingdom and play a mainly protective role in host defense. Lysozymes damage bacterial cell walls by catalyzing hydrolysis of 1,4-beta-linkages between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in a peptidoglycan and between N-acetyl-D-glucosamine residues in chitodextrins.

Lysozyme is part of the innate immune system. Reduced lysozyme levels have been associated with bronchopulmonary dysplasia in newborns. In certain cancers (especially myelomonocytic leukemia) excessive production of lysozyme by cancer cells can lead to toxic levels of lysozyme in the blood. High lysozyme blood levels can lead to kidney failure and low blood potassium, conditions that may improve or resolve with treatment of the primary malignancy.

참고자료
  • Lamesch P. et al., 2007, Genomics. 89 (3): 307-15.
  • Argyropoulos G. et al., 2009, Physiol Genomics. 36 (2): 79-88.
  • Deloukas P. et al., 2004, Nature. 429 (6990): 375-81.
  • Size / Price
    Cat No: HG13726-NM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".