휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmid, N-Myc 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 MAPK8 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_139047.1
    cDNA 크기:1284bp
    cDNA 설명:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 8, transcript variant JNK1-b2 with N terminal Myc tag.
    유전자 동의어:JNK, JNK1, PRKM8, SAPK1, JNK1A2, JNK21B1/2
    :Human
    벡터:pCMV3-N-Myc
    Plasmid:
    제한 사이트:
    태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MAPK8 qPCR primers for gene expression analysis, HP100709 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmid, N-Myc 태그 on other vectors
    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10795-ACG265260
    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10795-ACR265260
    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG10795-ANG265260
    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG10795-ANR265260
    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10795-CF229890
    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmid, C-His 태그HG10795-CH229890
    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10795-CM229890
    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmid, C-HA 태그HG10795-CY229890
    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone in cloning vectorHG10795-M88420
    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10795-M-F229890
    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmidHG10795-M-N229890
    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10795-NF229890
    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmid, N-His 태그HG10795-NH229890
    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10795-NM229890
    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmid, N-HA 태그HG10795-NY229890
    휴먼 JNK1 / MAPK8 transcript variant JNK1-b2 Gene ORF cDNA clone expression plasmidHG10795-UT229890
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    연구배경

    Mitogen-activated protein kinase 8 (MAPK8), also known as JNK1, is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The protein kinases JNK1 has been found to serve as critical molecular links between obesity, metabolic inflammation, and disorders of glucose homeostasis. It is critically involved in the promotion of diet-induced obesity, metabolic inflammation and beta-cell dysfunction. The selective deficiency of JNK1 in the murine nervous system is sufficient to suppress diet-induced obesity. Genetic analysis indicates that the effects of JNK1 can be separated from effects of JNK1 on obesity. JNK1 is a potential pharmacological target for the development of drugs that might be useful for the treatment of metabolic syndrome, and type 2 diabetes. Furthermore, JNK1 plays a major role in the hypoxic cellular damage. JNK1 protein might be an attractive target for antihypoxic therapy in increasing resistance to many pathological conditions and diseases, leading to the oxygen deficit.

    참고자료
  • Betigeri S, et al. (2006) JNK1 as a molecular target to limit cellular mortality under hypoxia. Mol Pharm. 3(4): 424-30.
  • Solinas G, et al. (2010) JNK1 and IKKbeta: molecular links between obesity and metabolic dysfunction. FASEB J. 24(8): 2596-611.
  • Sabio G, et al. (2010) Role of the hypothalamic-pituitary-thyroid axis in metabolic regulation by JNK1. Genes Dev. 24(3): 256-64.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".