After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 MARK3/C-TAK1 Gene ORF cDNA clone expression plasmid, C-Myc 태그

데이터시트리뷰관련제품프로토콜
Human MARK3 cDNA 클론 제품 정보
Gene_bank_ref_id:BC024773
cDNA 크기:2190bp
cDNA 설명:Full length Clone DNA of Homo sapiens MAP/microtubule affinity-regulating kinase 3 with C terminal Myc tag.
유전자 동의어:KP78, CTAK1, PAR1A, Par-1a, MARK3
:Human
벡터:pCMV3-C-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
연구배경

MAP / microtubule affinity-regulating kinase 3, also known as C-TAK1, cTAK1, Cdc25C-associated protein kinase 1, ELKL motif kinase 2, Protein kinase STK10, Ser/Thr protein kinase PAR-1, Serine/threonine-protein kinase p78, MARK3, CTAK1 and EMK2, is a ubiquitous expressed protein which belongs to the protein kinase superfamily, CAMK Ser / Thr protein kinase family and MARK subfamily. MARK3 contains one KA1 (kinase-associated) domain, one protein kinase domain and one UBA domain. The Par-1 / MARK protein kinases play a pivotal role in establishing cellular polarity. This family of kinases contains a unique domain architecture, in which a ubiquitin-associated (UBA) domain is located C-terminal to the kinase domain. MARKs / PAR-1 are common regulators of cell polarity that are conserved from nematode to human. All of these kinases have a highly conserved C-terminal domain, which is termed the kinase-associated domain 1 (KA1).

참고자료
  • Kato,T. et al., 2001, Neoplasia.3 (1):4-9.
  • Tochio,N. et al., 2006, Protein Sci. 15 (11):2534-43.
  • Murphy,J.M. et al., 2007, Proc Natl Acad Sci USA.104 (36):14336-41.
  • de Leng,W.W. et al., 2007,Clin Genet. 72 (6):568-73.
  • Chia,C.Y. et al., 2010, IUBMB Life. 62 (3):200-3.
  • Size / Price
    Cat No: HG12181-CM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".