After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 MDGA2 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human MDGA2 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001113498.1
cDNA 크기:2871bp
cDNA 설명:Full length Clone DNA of Homo sapiens MAM domain containing glycosylphosphatidylinositol anchor 2 with N terminal His tag.
유전자 동의어:MAMDC1, c14_5286, MDGA2
:Human
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

Mouse MAM domain-containing glycosylphosphatidylinositol anchor protein 2, also known as MAM domain-containing protein 1, MDGA2 and MAMDC1, is a cell membrane protein which contains six Ig-like (immunoglobulin-like) domains and one MAM domain. Analyses of the full-length coding region of MDGA1 and MDGA2 indicate that they encode proteins that comprise a novel subgroup of the Ig superfamily and have a unique structural organization consisting of six immunoglobulin (Ig)-like domains followed by a single MAM domain. Biochemical characterization demonstrates that MDGA1 and MDGA2 proteins are highly glycosylated, and that MDGA1 is tethered to the cell membrane by a GPI anchor. The MDGAs are differentially expressed by subpopulations of neurons in both the central and peripheral nervous systems, including neurons of the basilar pons, inferior olive, cerebellum, cerebral cortex, olfactory bulb, spinal cord, and dorsal root and trigeminal ganglia. The similarity of MDGAs to other Ig-containing molecules and their temporal-spatial patterns of expression within restricted neuronal populations, for example migrating pontine neurons and D1 spinal interneurons, suggest a role for these novel proteins in regulating neuronal migration, as well as other aspects of neural development, including axon guidance.

참고자료
  • Litwack,ED. et al., 2004, Mol Cell Neurosci. 25 (2): 263-74.
  • Hellquist, A. et al., 2009, PLoS One. 4 (12): e8037.
  • Sano,S. et al., 2009, Genesis. 47 (8):505-13.
  • Bucan, M. et al., 2009, PLoS Genet. 5 (6):e1000536.
  • Size / Price
    Cat No: HG11372-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".