After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Meteorin / METRN Gene ORF cDNA clone expression plasmid, N-HA 태그

데이터시트리뷰관련제품프로토콜
Human METRN cDNA 클론 제품 정보
Gene_bank_ref_id:NM_006010.3
cDNA 크기:882bp
cDNA 설명:Full length Clone DNA of Homo sapiens meteorin, glial cell differentiation regulator with N terminal HA tag.
유전자 동의어:MGC2601, C16orf23, c380A1.2, METRN
:Human
벡터:pCMV3-SP-N-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
연구배경

Meteorin is a novel secreted protein that is expressed in undifferentiated neural progenitors and in the astrocyte lineage, including radial glia. It plays important roles in the differentiation of glial cells and also in axonal network formation during neurogenesis. Meteorin selectively promoted astrocyte formation from mouse cerebrocortical neurospheres in differentiation culture, whereas it induced cerebellar astrocytes to become radial glia. Meteorin also induced axonal extension in small and intermediate neurons of sensory ganglia by activating nearby satellite glia.

참고자료
  • Martin J, et al. (2004) The sequence and analysis of duplication-rich human chromosome 16. Nature. 432(7020):988-94.
  • Nishino J, et al. (2004) Meteorin: a secreted protein that regulates glial cell differentiation and promotes axonal extension. EMBO J. 23(9):1998-2008.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Size / Price
    Cat No: HG13433-NY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".