MGAT5 cDNA ORF Clone, Human, N-His tag

Cat: HG11373-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MGAT5 Reagents

CRO Services

Product recommended


All MGAT5 Reagents

MGAT5 cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2226 bp
Description
Full length Clone DNA of Human mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MGAT5 cDNA ORF Clone, Human, N-His tag Alternative Names

GNT-V cDNA ORF Clone, Human;GNT-VA cDNA ORF Clone, Human

MGAT5 Background Information

Alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase A, also known as Alpha-mannoside beta-1,6-N-acetylglucosaminyl-transferase, Mannoside acetylglucosaminyltransferase 5, N-acetylglucosaminyl-transferase V, MGAT5 and GGNT5, is a single-pass type I I membrane protein which belongs to the glycosyltransferase 18 family. MGAT5 / GGNT5 catalyzes the addition of N-acetylglucosamine in beta 1-6 linkage to the alpha-linked mannose of biantennary N-linked oligosaccharides. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. The central nervous system (CNS) is rich in glycoconjugates, located on cell surface and in extracellular matrix. MGAT5 / GGNT5 modification of complex-type N-glycans on CNS glycoproteins is involved in the regulation of depression-like behavior. Inhibitors of MGAT5 / GGNT5 might be useful in the treatment of malignancies by targeting their dependency on focal adhesion signaling for growth and metastasis.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
References
  • Morgan,R. et al., 2004,J Immunol  173 (12): 7200-8.
  • Cheung,P. et al., 2007,Glycobiology  17 (7): 767-73.
  • Li,D. et al., 2008, J Immunol 180 (5): 3158-65.
  • Soleimani,L. et al., 2008, Genes Brain Behav. 7 (3):334-43.
  • info info
    添加购物车成功! 添加购物车失败!