휴먼 MICA Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
휴먼 MICA cDNA 클론 제품 정보
Gene_bank_ref_id:BC016929
cDNA 크기:1176 bp
cDNA 설명:Full length Clone DNA of Homo sapiens MHC class I polypeptide-related sequence A with N terminal His tag.
유전자 동의어:MIC-A, PERB11.1, MICA
:Human
벡터:pCMV3-SP-N-His
Plasmid:pCMV3-SP-His-MICA
제한 사이트:KpnI + XbaI(6kb+1.18kb)
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with MICA qPCR primers for gene expression analysis, HP100031 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

MHC class I chain-related molecules A (MICA) is one of the genes in the HLA class I region, which belongs to MHC class I family. It is the member of the non-classical class I family that displays the greatest degree of polymorphism. The MICA protein product is expressed on the cell surface, although unlike canonical class I molecules does not seem to associate with beta-2-microglobulin. It is thought that MICA functions as a stress-induced antigen that is broadly recognized by NK cells, NKT cells, and most of the subtypes of T cells. The Natural killer group 2D (NKG2D), a C-type lectin-like activating immunoreceptor, is a receptor of MICA, which was detected on most gammadelta T cells, CD8+ alphabeta T cells, and natural killer (NK) cells. Effector cells from all these subsets could be stimulated by ligation of NKG2D. Engagement of NKG2D activated cytolytic responses of gammadelta T cells and NK cells against transfectants and epithelial tumor cells expressing MICA. The MICA system is a novel, avidin-free immunohistochemical detection system that provides a significant increase in sensitivity compared to traditional immunodetection systems.

참고자료
  • Choy MK, et al. (2010) MICA polymorphism: biology and importance in immunity and disease. Trends Mol Med. 16(3): 97-106.
  • Li J, et al. (2005) Distinct pattern of human Vdelta1 gammadelta T cells recognizing MICA. Cell Mol Immunol. 2(4): 253-8.
  • Mangham DC, et al. (2000) MICA-a highly sensitive and avidin-free immunohistochemical detection system. Adv Anat Pathol. 7(6): 360-4.
  • Bauer S, et al. (1999) Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science. 285(5428): 727-9.
  • Groh V, et al. (1998) Recognition of stress-induced MHC molecules by intestinal epithelial gammadelta T cells. Science. 279: 1737-40.
  • Size / Price
    Cat No: HG12302-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    장바구니에 추가대량 주문 문의
    Contact Us
    이미지
    • Rhesus CD3d/CD3 delta Gene Plasmid Map 5615
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".