Text Size:AAA

휴먼 MICB Gene ORF cDNA clone expression plasmid, N-His 태그

  • Rhesus CD3d/CD3 delta Gene Plasmid Map 5615
데이터시트리뷰관련제품프로토콜
휴먼 MICB cDNA 클론 제품 정보
Gene_bank_ref_id:NM_005931.2
cDNA 크기:1179 bp
cDNA 설명:Full length Clone DNA of Homo sapiens MHC class I polypeptide-related sequence B with N terminal His tag.
유전자 동의어:PERB11.2, MICB
:Human
벡터:pCMV3-SP-N-His
Plasmid:pCMV3-SP-His-MICB
제한 사이트:KpnI + XbaI(6kb+1.18kb)
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with MICB qPCR primers for gene expression analysis, HP100035 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

MHC class I polypeptide-related sequence B, also known as MICB, is a heavily glycosylated protein serving as a ligand for the type I I receptor NKG2D. MICB shares 85% amino acid identity with MICA, a closely related protein, both of which contain three extracellular immunoglobulin-like domains, but without capacity to bind peptide or interact with beta-2-microglobulin. acting as a stress-induced self-antigen, binding of MICB to the NKG2D receptor activates the cytolytic response of natural killer (NK) cells, CD8+αβ T cells, and γδ T cells on which the receptor is expressed. MICA/B are minimally expressed on normal cells, but are frequently expressed on epithelial tumors and can be induced by bacterial and viral infections. MICA/B recognition thus is involved in tumor surveillance, viral infections, and autoimmune diseases.

참고자료
  • Bauer, S. et al., 1999, Science. 285:727-729.
  • Braud, V.M. et al., 1999, Curr. Opin. Immunol. 11: 100-108.
  • Groh, V. et al., 2001, Nature Immunol. 2: 255-260.
  • Stephens, H., 2001, Trends Immunol. 22: 378-385.
  • Borrego, F. et al., 2002, Mol. Immunol. 38: 637–660.
  • Groh, V. et al., 2002, Nature. 419:734-738.
  • Size / Price
    Cat No: HG10759-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    장바구니에 추가대량 주문 문의

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".