After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 MMGT1 / EMC5 Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Human MMGT1 cDNA 클론 제품 정보
Gene_bank_ref_id:BC033588
cDNA 크기:396bp
cDNA 설명:Full length Clone DNA of Homo sapiens membrane magnesium transporter 1 with C terminal His tag.
유전자 동의어:EMC5, TMEM32, MMGT1
:Human
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
연구배경

MMGT1, also known as EMC5, is comparable with primary microglial cells with respect to morphology, presence of acetylated low density lipoprotein receptor, non-specific esterase, CD63, major histocompatibility complex antigens and CD11, and binding for Ricinus communis agglutinin. Primary microglia as well as MMGT1 cells are negative for glial fibrillary acidic protein. Different MMGT1 strains are obtained after subcloning, two of which resembled histiocytes (F4/80 and BM-8). These cell strains, MMGT12 and 16, are able to opsonize latex beads, and could be induced by endotoxins (LPS) to secrete TNF-alpha, IL-1, IL-6, TGF-beta, and EGF.

참고자료
  • Goytain A. et al., 2008, Am J Physiol Cell Physiol. 294 (2): C495-502.
  • Briers TW. et al., 1994, J Neuroimmunol. 52 (2): 153-64.
  • Jäger S. et al., 2011, Nature. 481 (7381): 365-70.
  • Size / Price
    Cat No: HG13998-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".