MMP-3 cDNA ORF Clone, Human, C-His tag

Cat: HG10467-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MMP-3 Reagents
CRO Services
Product recommended

All MMP-3 Reagents
MMP-3 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1479 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 288T/C,306C/G,1086T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human matrix metallopeptidase 3 (stromelysin 1, progelatinase) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI(two restriction sites) + NotI(6kb+0.83kb+0.67kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MMP-3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MMP-3 cDNA ORF Clone, Human, C-His tag Validated Images
Human MMP-3 Gene Plasmid Map 17474
MMP-3 cDNA ORF Clone, Human, C-His tag Alternative Names
CHDS6 cDNA ORF Clone, Human;MMP-3 cDNA ORF Clone, Human;SL-1 cDNA ORF Clone, Human;STMY cDNA ORF Clone, Human;STMY1 cDNA ORF Clone, Human;STR1 cDNA ORF Clone, Human
MMP-3 Background Information

Matrix metallopeptidase 3 (abbreviated as MMP3) is also known as stromelysin 1 and progelatinase. MMP3 is a member of the matrix metalloproteinase (MMP) family whose members are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, tissue remodeling, and disease processes including arthritis and metastasis. As a secreted zinc-dependent endopeptidase, MMP3 exerts its functions mainly in extracellular matrix. This protein is activated by two major endogenous inhibitors: alpha2-macroglobulin and tissue inhibitors of metalloproteases (TIMPs). MMP3 plays a central role in degrading collagen types II, III, IV, IX, and X, proteoglycans, fibronectin, laminin, and elastin. In addition, MMP3 can also active other MMPs such as MMP1, MMP7, and MMP9, rendering MMP3 crucial in connective tissue remodeling. Dysregulatoin of MMPs has been implicated in many diseases including arthritis, chronic ulcers, encephalomyelitis and cancer. Synthetic or natural inhibitors of MMPs result in inhibition of metastasis, while up-regulation of MMPs led to enhanced cancer cell invasion.

Full Name
matrix metallopeptidase 3
References
  • Sternlicht MD, et al. 1999, The stromal proteinase MMP3/stromelysin-1 promotes mammary carcinogenesis. Cell. 98(2): 137-46.
  • Yoon S, et al. (1999) Genetic analysis of MMP3, MMP9, and PAI-1 in Finnish patients with abdominal aortic or intracranial aneurysms. Biochem Biophys Res Commun. 265(2): 563-8.
  • Biondi ML, et al. (2000) MMP1 and MMP3 polymorphisms in promoter regions and cancer. Clin Chem. 46(12): 2023-4.
  • info info
    添加购物车成功! 添加购物车失败!