MORF4L1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG16282-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MORF4L1 Reagents

CRO Services

Product recommended


All MORF4L1 Reagents

MORF4L1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
972 bp
Description
Full length Clone DNA of Human mortality factor 4 like 1 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MORF4L1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

Eaf3 cDNA ORF Clone, Human;FWP006 cDNA ORF Clone, Human;HsT17725 cDNA ORF Clone, Human;MEAF3 cDNA ORF Clone, Human;MORFRG15 cDNA ORF Clone, Human;MRG15 cDNA ORF Clone, Human;S863-6 cDNA ORF Clone, Human

MORF4L1 Background Information

Full Name
mortality factor 4 like 1

MORF4L1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MORF4L1 cDNA ORF Clone in Cloning Vector, Rat RG81030-U
MORF4L1 cDNA ORF Clone, Rat, untagged RG81030-UT
MORF4L1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81030-ACG
MORF4L1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81030-ACGLN
MORF4L1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81030-ANG
MORF4L1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81030-ACR
MORF4L1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81030-ANR
MORF4L1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81030-CF
MORF4L1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81030-NF
MORF4L1 cDNA ORF Clone, Rat, C-His tag RG81030-CH
MORF4L1 cDNA ORF Clone, Rat, N-His tag RG81030-NH
MORF4L1 cDNA ORF Clone, Rat, C-HA tag RG81030-CY
MORF4L1 cDNA ORF Clone, Rat, N-HA tag RG81030-NY
MORF4L1 cDNA ORF Clone, Rat, C-Myc tag RG81030-CM
MORF4L1 cDNA ORF Clone, Rat, N-Myc tag RG81030-NM
MORF4L1 qPCR Primer Pairs, Rat RP300994

MORF4L1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MORF4L1 cDNA ORF Clone in Cloning Vector, Mouse MG53649-U
MORF4L1 cDNA ORF Clone, Mouse, untagged MG53649-UT
MORF4L1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53649-ACG
MORF4L1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53649-ACGLN
MORF4L1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53649-ANG
MORF4L1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53649-ACR
MORF4L1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53649-ANR
MORF4L1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53649-CF
MORF4L1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53649-NF
MORF4L1 cDNA ORF Clone, Mouse, C-His tag MG53649-CH
MORF4L1 cDNA ORF Clone, Mouse, N-His tag MG53649-NH
MORF4L1 cDNA ORF Clone, Mouse, C-HA tag MG53649-CY
MORF4L1 cDNA ORF Clone, Mouse, N-HA tag MG53649-NY
MORF4L1 cDNA ORF Clone, Mouse, C-Myc tag MG53649-CM
MORF4L1 cDNA ORF Clone, Mouse, N-Myc tag MG53649-NM

MORF4L1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MORF4L1 cDNA ORF Clone in Cloning Vector, Human HG16282-G
MORF4L1 cDNA ORF Clone, Human, untagged HG16282-UT
MORF4L1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16282-ACG
MORF4L1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16282-ACGLN
MORF4L1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16282-ANG
MORF4L1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16282-ACR
MORF4L1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16282-ANR
MORF4L1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16282-NF
MORF4L1 cDNA ORF Clone, Human, C-His tag HG16282-CH
MORF4L1 cDNA ORF Clone, Human, N-His tag HG16282-NH
MORF4L1 cDNA ORF Clone, Human, C-HA tag HG16282-CY
MORF4L1 cDNA ORF Clone, Human, N-HA tag HG16282-NY
MORF4L1 cDNA ORF Clone, Human, C-Myc tag HG16282-CM
MORF4L1 cDNA ORF Clone, Human, N-Myc tag HG16282-NM
MORF4L1 qPCR Primer Pairs, Human HP105036
info info
添加购物车成功! 添加购物车失败!