MPST cDNA ORF Clone, Human, C-HA tag

Cat: HG16368-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MPST Reagents

CRO Services

Product recommended


All MPST Reagents

MPST cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
954 bp
Description
Full length Clone DNA of Human mercaptopyruvate sulfurtransferase with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MPST cDNA ORF Clone, Human, C-HA tag Alternative Names

MST cDNA ORF Clone, Human;TST2 cDNA ORF Clone, Human;TUM1 cDNA ORF Clone, Human

MPST Background Information

Full Name
mercaptopyruvate sulfurtransferase

MPST cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MPST cDNA ORF Clone in Cloning Vector, Rat RG81205-U
MPST cDNA ORF Clone, Rat, untagged RG81205-UT
MPST Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81205-ACGLN
MPST cDNA ORF Clone, Rat, C-GFPSpark® tag RG81205-ACG
MPST cDNA ORF Clone, Rat, N-GFPSpark® tag RG81205-ANG
MPST cDNA ORF Clone, Rat, C-OFPSpark® tag RG81205-ACR
MPST cDNA ORF Clone, Rat, N-OFPSpark® tag RG81205-ANR
MPST cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81205-CF
MPST cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81205-NF
MPST cDNA ORF Clone, Rat, C-His tag RG81205-CH
MPST cDNA ORF Clone, Rat, N-His tag RG81205-NH
MPST cDNA ORF Clone, Rat, C-HA tag RG81205-CY
MPST cDNA ORF Clone, Rat, N-HA tag RG81205-NY
MPST cDNA ORF Clone, Rat, C-Myc tag RG81205-CM
MPST cDNA ORF Clone, Rat, N-Myc tag RG81205-NM
MPST qPCR Primer Pairs, Rat RP301161

MPST cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MPST cDNA ORF Clone in Cloning Vector, Mouse MG53460-U
MPST cDNA ORF Clone, Mouse, untagged MG53460-UT
MPST cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53460-ACG
MPST Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53460-ACGLN
MPST cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53460-ANG
MPST cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53460-ACR
MPST cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53460-ANR
MPST cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53460-CF
MPST cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53460-NF
MPST cDNA ORF Clone, Mouse, C-His tag MG53460-CH
MPST cDNA ORF Clone, Mouse, N-His tag MG53460-NH
MPST cDNA ORF Clone, Mouse, C-HA tag MG53460-CY
MPST cDNA ORF Clone, Mouse, N-HA tag MG53460-NY
MPST cDNA ORF Clone, Mouse, C-Myc tag MG53460-CM
MPST cDNA ORF Clone, Mouse, N-Myc tag MG53460-NM

MPST cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MPST cDNA ORF Clone in Cloning Vector, Human HG16368-G
MPST cDNA ORF Clone, Human, untagged HG16368-UT
MPST Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16368-ACGLN
MPST cDNA ORF Clone, Human, C-GFPSpark® tag HG16368-ACG
MPST cDNA ORF Clone, Human, N-GFPSpark® tag HG16368-ANG
MPST cDNA ORF Clone, Human, C-OFPSpark® tag HG16368-ACR
MPST cDNA ORF Clone, Human, N-OFPSpark® tag HG16368-ANR
MPST cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16368-CF
MPST cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16368-NF
MPST cDNA ORF Clone, Human, C-His tag HG16368-CH
MPST cDNA ORF Clone, Human, N-His tag HG16368-NH
MPST cDNA ORF Clone, Human, N-HA tag HG16368-NY
MPST cDNA ORF Clone, Human, C-Myc tag HG16368-CM
MPST cDNA ORF Clone, Human, N-Myc tag HG16368-NM
MPST qPCR Primer Pairs, Human HP105118
info info
添加购物车成功! 添加购物车失败!