MRPS24 cDNA ORF Clone, Human, C-HA tag

Cat: HG16377-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MRPS24 Reagents

CRO Services

Product recommended


All MRPS24 Reagents

MRPS24 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
504 bp
Description
Full length Clone DNA of Human mitochondrial ribosomal protein S24 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPS24 cDNA ORF Clone, Human, C-HA tag Alternative Names

bMRP-47 cDNA ORF Clone, Human;bMRP47 cDNA ORF Clone, Human;HSPC335 cDNA ORF Clone, Human;MRP-S24 cDNA ORF Clone, Human;S24mt cDNA ORF Clone, Human

MRPS24 Background Information

Full Name
mitochondrial ribosomal protein S24

MRPS24 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRPS24 cDNA ORF Clone in Cloning Vector, Mouse MG51553-G
MRPS24 cDNA ORF Clone, Mouse, untagged MG51553-UT
MRPS24 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51553-ACGLN
MRPS24 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51553-ACG
MRPS24 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51553-ANG
MRPS24 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51553-ACR
MRPS24 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51553-ANR
MRPS24 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51553-CF
MRPS24 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51553-NF
MRPS24 cDNA ORF Clone, Mouse, C-His tag MG51553-CH
MRPS24 cDNA ORF Clone, Mouse, N-His tag MG51553-NH
MRPS24 cDNA ORF Clone, Mouse, C-HA tag MG51553-CY
MRPS24 cDNA ORF Clone, Mouse, N-HA tag MG51553-NY
MRPS24 cDNA ORF Clone, Mouse, C-Myc tag MG51553-CM
MRPS24 cDNA ORF Clone, Mouse, N-Myc tag MG51553-NM
MRPS24 qPCR Primer Pairs, Mouse MP201437

MRPS24 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRPS24 cDNA ORF Clone in Cloning Vector, Human HG16377-G
MRPS24 cDNA ORF Clone, Human, untagged HG16377-UT
MRPS24 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16377-ACGLN
MRPS24 cDNA ORF Clone, Human, C-GFPSpark® tag HG16377-ACG
MRPS24 cDNA ORF Clone, Human, N-GFPSpark® tag HG16377-ANG
MRPS24 cDNA ORF Clone, Human, C-OFPSpark® tag HG16377-ACR
MRPS24 cDNA ORF Clone, Human, N-OFPSpark® tag HG16377-ANR
MRPS24 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16377-CF
MRPS24 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16377-NF
MRPS24 cDNA ORF Clone, Human, C-His tag HG16377-CH
MRPS24 cDNA ORF Clone, Human, N-His tag HG16377-NH
MRPS24 cDNA ORF Clone, Human, N-HA tag HG16377-NY
MRPS24 cDNA ORF Clone, Human, C-Myc tag HG16377-CM
MRPS24 cDNA ORF Clone, Human, N-Myc tag HG16377-NM
MRPS24 qPCR Primer Pairs, Human HP105127
info info
添加购物车成功! 添加购物车失败!