MSL3 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14885-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MSL3 Reagents

CRO Services

Product recommended


All MSL3 Reagents

MSL3 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1566 bp
Description
Full length Clone DNA of Human male-specific lethal 3 homolog (Drosophila) with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MSL3 cDNA ORF Clone, Human, N-Myc tag Alternative Names

MSL3L1 cDNA ORF Clone, Human

MSL3 Background Information

Full Name
male-specific lethal 3 homolog (Drosophila)

MSL3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MSL3 cDNA ORF Clone in Cloning Vector, Rat RG8A1009-U
MSL3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1009-ACGLN

MSL3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MSL3 cDNA ORF Clone in Cloning Vector, Mouse MG53889-U
MSL3 cDNA ORF Clone, Mouse, untagged MG53889-UT
MSL3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53889-ACG
MSL3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53889-ACGLN
MSL3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53889-ANG
MSL3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53889-ACR
MSL3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53889-ANR
MSL3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53889-CF
MSL3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53889-NF
MSL3 cDNA ORF Clone, Mouse, C-His tag MG53889-CH
MSL3 cDNA ORF Clone, Mouse, N-His tag MG53889-NH
MSL3 cDNA ORF Clone, Mouse, C-HA tag MG53889-CY
MSL3 cDNA ORF Clone, Mouse, N-HA tag MG53889-NY
MSL3 cDNA ORF Clone, Mouse, C-Myc tag MG53889-CM
MSL3 cDNA ORF Clone, Mouse, N-Myc tag MG53889-NM

MSL3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MSL3 cDNA ORF Clone in Cloning Vector, Human HG14885-G
MSL3 cDNA ORF Clone, Human, untagged HG14885-UT
MSL3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14885-ACG
MSL3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14885-ACGLN
MSL3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14885-ANG
MSL3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14885-ACR
MSL3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14885-ANR
MSL3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14885-CF
MSL3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14885-NF
MSL3 cDNA ORF Clone, Human, C-His tag HG14885-CH
MSL3 cDNA ORF Clone, Human, N-His tag HG14885-NH
MSL3 cDNA ORF Clone, Human, C-HA tag HG14885-CY
MSL3 cDNA ORF Clone, Human, N-HA tag HG14885-NY
MSL3 cDNA ORF Clone, Human, C-Myc tag HG14885-CM
MSL3 qPCR Primer Pairs, Human HP103515
info info
添加购物车成功! 添加购物车失败!