MTMR7 cDNA ORF Clone, Human, C-His tag

Cat: HG15749-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MTMR7 Reagents

CRO Services

Product recommended


All MTMR7 Reagents

MTMR7 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1983 bp
Description
Full length Clone DNA of Human myotubularin related protein 7 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MTMR7 Background Information

Full Name
myotubularin related protein 7

MTMR7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MTMR7 cDNA ORF Clone in Cloning Vector, Mouse MG52468-G
MTMR7 cDNA ORF Clone, Mouse, untagged MG52468-UT
MTMR7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52468-ACGLN
MTMR7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52468-ACG
MTMR7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52468-ANG
MTMR7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52468-ACR
MTMR7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52468-ANR
MTMR7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52468-CF
MTMR7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52468-NF
MTMR7 cDNA ORF Clone, Mouse, C-His tag MG52468-CH
MTMR7 cDNA ORF Clone, Mouse, N-His tag MG52468-NH
MTMR7 cDNA ORF Clone, Mouse, C-HA tag MG52468-CY
MTMR7 cDNA ORF Clone, Mouse, N-HA tag MG52468-NY
MTMR7 cDNA ORF Clone, Mouse, C-Myc tag MG52468-CM
MTMR7 cDNA ORF Clone, Mouse, N-Myc tag MG52468-NM
MTMR7 qPCR Primer Pairs, Mouse MP202341

MTMR7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MTMR7 cDNA ORF Clone in Cloning Vector, Human HG15749-G
MTMR7 cDNA ORF Clone, Human, untagged HG15749-UT
MTMR7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15749-ACGLN
MTMR7 cDNA ORF Clone, Human, C-GFPSpark® tag HG15749-ACG
MTMR7 cDNA ORF Clone, Human, N-GFPSpark® tag HG15749-ANG
MTMR7 cDNA ORF Clone, Human, C-OFPSpark® tag HG15749-ACR
MTMR7 cDNA ORF Clone, Human, N-OFPSpark® tag HG15749-ANR
MTMR7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15749-CF
MTMR7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15749-NF
MTMR7 cDNA ORF Clone, Human, N-His tag HG15749-NH
MTMR7 cDNA ORF Clone, Human, C-HA tag HG15749-CY
MTMR7 cDNA ORF Clone, Human, N-HA tag HG15749-NY
MTMR7 cDNA ORF Clone, Human, C-Myc tag HG15749-CM
MTMR7 cDNA ORF Clone, Human, N-Myc tag HG15749-NM
MTMR7 qPCR Primer Pairs, Human HP104342
info info
添加购物车成功! 添加购物车失败!