MTPAP cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16330-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MTPAP Reagents

CRO Services

Product recommended


All MTPAP Reagents

MTPAP cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1749 bp
Description
Full length Clone DNA of Human mitochondrial poly(A) polymerase with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MTPAP cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

PAPD1 cDNA ORF Clone, Human;SPAX4 cDNA ORF Clone, Human

MTPAP Background Information

Full Name
mitochondrial poly(A) polymerase

MTPAP cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
MTPAP cDNA ORF Clone in Cloning Vector, Rhesus CG90842-G
MTPAP cDNA ORF Clone, Rhesus, untagged CG90842-UT
MTPAP cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90842-ACG
MTPAP Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90842-ACGLN
MTPAP cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90842-ANG
MTPAP cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90842-ACR
MTPAP cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90842-ANR
MTPAP cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90842-CF
MTPAP cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90842-NF
MTPAP cDNA ORF Clone, Rhesus, C-His tag CG90842-CH
MTPAP cDNA ORF Clone, Rhesus, N-His tag CG90842-NH
MTPAP cDNA ORF Clone, Rhesus, C-HA tag CG90842-CY
MTPAP cDNA ORF Clone, Rhesus, N-HA tag CG90842-NY
MTPAP cDNA ORF Clone, Rhesus, C-Myc tag CG90842-CM
MTPAP cDNA ORF Clone, Rhesus, N-Myc tag CG90842-NM

MTPAP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MTPAP cDNA ORF Clone in Cloning Vector, Mouse MG52112-G
MTPAP cDNA ORF Clone, Mouse, untagged MG52112-UT
MTPAP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52112-ACGLN
MTPAP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52112-ACG
MTPAP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52112-ANG
MTPAP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52112-ACR
MTPAP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52112-ANR
MTPAP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52112-CF
MTPAP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52112-NF
MTPAP cDNA ORF Clone, Mouse, C-His tag MG52112-CH
MTPAP cDNA ORF Clone, Mouse, N-His tag MG52112-NH
MTPAP cDNA ORF Clone, Mouse, C-HA tag MG52112-CY
MTPAP cDNA ORF Clone, Mouse, N-HA tag MG52112-NY
MTPAP cDNA ORF Clone, Mouse, C-Myc tag MG52112-CM
MTPAP cDNA ORF Clone, Mouse, N-Myc tag MG52112-NM
MTPAP qPCR Primer Pairs, Mouse MP201985

MTPAP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MTPAP cDNA ORF Clone in Cloning Vector, Human HG16330-G
MTPAP cDNA ORF Clone, Human, untagged HG16330-UT
MTPAP cDNA ORF Clone, Human, C-GFPSpark® tag HG16330-ACG
MTPAP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16330-ACGLN
MTPAP cDNA ORF Clone, Human, N-GFPSpark® tag HG16330-ANG
MTPAP cDNA ORF Clone, Human, C-OFPSpark® tag HG16330-ACR
MTPAP cDNA ORF Clone, Human, N-OFPSpark® tag HG16330-ANR
MTPAP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16330-CF
MTPAP cDNA ORF Clone, Human, C-His tag HG16330-CH
MTPAP cDNA ORF Clone, Human, N-His tag HG16330-NH
MTPAP cDNA ORF Clone, Human, C-HA tag HG16330-CY
MTPAP cDNA ORF Clone, Human, N-HA tag HG16330-NY
MTPAP cDNA ORF Clone, Human, C-Myc tag HG16330-CM
MTPAP cDNA ORF Clone, Human, N-Myc tag HG16330-NM
MTPAP qPCR Primer Pairs, Human HP105083
info info
添加购物车成功! 添加购物车失败!