After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human NEK3 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_152720.1
cDNA 크기:1521bp
cDNA 설명:Full length Clone DNA of Homo sapiens NIMA (never in mitosis gene a)-related kinase 3, transcript variant 2.
유전자 동의어:HSPK36, MGC29949, NEK3
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-NEK3
제한 사이트:KpnI + XbaI (6.1kb + 1.52kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1236T/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human NEK3 Gene Plasmid Map
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone expression plasmid on other vectors
휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10675-ACG288840
휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10675-ACR288840
휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG10675-ANG288840
휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG10675-ANR288840
휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10675-CF253470
휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His 태그HG10675-CH253470
휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10675-CM253470
휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA 태그HG10675-CY253470
휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone in cloning vectorHG10675-M88420
휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10675-M-F253470
휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10675-NF253470
휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His 태그HG10675-NH253470
휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10675-NM253470
휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA 태그HG10675-NY253470
휴먼 NEK3 transcript variant 2 Gene ORF cDNA clone expression plasmidHG10675-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

NEK3 (NIMA (never in mitosis gene a)-related expressed kinase 3), contains 1 protein kinase domain and is a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. Members of the NEK family of protein kinases share high amino acid homology with NIMA (never in mitosis gene a). NEK3 differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. It is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. NEK3 mRNA can be detected in all the proliferating cell lines with the amount not changing during the cell cycle. Prolactin stimulates interaction between NEK3 and paxillin leading to increased paxillin phosphorylation, Analysis of breast tissue microarrays show a significant up-regulation of NEK3 expression in malignant versus normal specimens. Multiple transcript variants encoding different isoforms have been found for NEK3 gene. NEK3 may play a role in mitotic regulation.

참고자료
  • Miller SL, et al. (2007) Nek3 kinase regulates prolactin-mediated cytoskeletal reorganization and motility of breast cancer cells. Oncogene. 26(32):4668-78.
  • Hernandez M, et al. (2006) Is there any association between nek3 and cancers with frequent 13q14 deletion?. Cancer Invest. 24(7):682-8.
  • Tanaka K, et al. (1999) Cloning and characterization of the murine Nek3 protein kinase, a novel member of the NIMA family of putative cell cycle regulators. J Biol Chem. 274(19):13491-7.
  • Size / Price
    Cat No: HG10675-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".