NEK3 cDNA ORF Clone, Human, untagged

Cat: HG10675-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NEK3 Reagents
CRO Services
Product recommended

All NEK3 Reagents
NEK3 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1521 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 1236T/G not causing the amino acid variation.
Description
Full length Clone DNA of Human NIMA (never in mitosis gene a)-related kinase 3, transcript variant 2.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 1.52kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
NEK3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NEK3 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
NEK3 cDNA ORF Clone, Human, untagged Alternative Names
HSPK36 cDNA ORF Clone, Human
NEK3 Background Information

NEK3 (NIMA (never in mitosis gene a)-related expressed kinase 3), contains 1 protein kinase domain and is a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. Members of the NEK family of protein kinases share high amino acid homology with NIMA (never in mitosis gene a). NEK3 differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. It is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. NEK3 mRNA can be detected in all the proliferating cell lines with the amount not changing during the cell cycle. Prolactin stimulates interaction between NEK3 and paxillin leading to increased paxillin phosphorylation, Analysis of breast tissue microarrays show a significant up-regulation of NEK3 expression in malignant versus normal specimens. Multiple transcript variants encoding different isoforms have been found for NEK3 gene. NEK3 may play a role in mitotic regulation.

Full Name
NIMA-related kinase 3
References
  • Miller SL, et al. (2007) Nek3 kinase regulates prolactin-mediated cytoskeletal reorganization and motility of breast cancer cells. Oncogene. 26(32):4668-78.
  • Hernandez M, et al. (2006) Is there any association between nek3 and cancers with frequent 13q14 deletion?. Cancer Invest. 24(7):682-8.
  • Tanaka K, et al. (1999) Cloning and characterization of the murine Nek3 protein kinase, a novel member of the NIMA family of putative cell cycle regulators. J Biol Chem. 274(19):13491-7.
  • NEK3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    NEK3 cDNA ORF Clone in Cloning Vector, Mouse MG50880-G
    NEK3 cDNA ORF Clone, Mouse, untagged MG50880-UT
    NEK3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50880-ACGLN
    NEK3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50880-ACG
    NEK3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50880-ANG
    NEK3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50880-ACR
    NEK3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50880-ANR
    NEK3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50880-CF
    NEK3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50880-NF
    NEK3 cDNA ORF Clone, Mouse, C-His tag MG50880-CH
    NEK3 cDNA ORF Clone, Mouse, N-His tag MG50880-NH
    NEK3 cDNA ORF Clone, Mouse, C-HA tag MG50880-CY
    NEK3 cDNA ORF Clone, Mouse, N-HA tag MG50880-NY
    NEK3 cDNA ORF Clone, Mouse, C-Myc tag MG50880-CM
    NEK3 cDNA ORF Clone, Mouse, N-Myc tag MG50880-NM
    NEK3 qPCR Primer Pairs, Mouse MP200851

    NEK3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    NEK3 cDNA ORF Clone in Cloning Vector, Human HG10675-M
    NEK3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10675-ACG
    NEK3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10675-ACGLN
    NEK3 cDNA ORF Clone, Human, N-GFPSpark® tag HG10675-ANG
    NEK3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10675-ACR
    NEK3 cDNA ORF Clone, Human, N-OFPSpark® tag HG10675-ANR
    NEK3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10675-CF
    NEK3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10675-NF
    NEK3 cDNA ORF Clone, Human, C-His tag HG10675-CH
    NEK3 cDNA ORF Clone, Human, N-His tag HG10675-NH
    NEK3 cDNA ORF Clone, Human, C-HA tag HG10675-CY
    NEK3 cDNA ORF Clone, Human, N-HA tag HG10675-NY
    NEK3 cDNA ORF Clone, Human, C-Myc tag HG10675-CM
    NEK3 cDNA ORF Clone, Human, N-Myc tag HG10675-NM
    NEK3 qPCR Primer Pairs, Human HP100940
    info info
    添加购物车成功! 添加购物车失败!