휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 NPM1 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_002520
    cDNA 크기:885bp
    cDNA 설명:Full length Clone DNA of Homo sapiens nucleophosmin (nucleolar phosphoprotein B23, numatrin) with C terminal HA tag.
    유전자 동의어:B23, NPM
    :Human
    벡터:pCMV3-C-HA
    Plasmid:
    제한 사이트:
    태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NPM1 qPCR primers for gene expression analysis, HP101603 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그 on other vectors
    휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG12074-ACG265260
    휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG12074-ACR265260
    휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG12074-ANG265260
    휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG12074-ANR265260
    휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG12074-CF229890
    휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그HG12074-CH229890
    휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG12074-CM229890
    휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG12074-CY229890
    휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone in cloning vectorHG12074-G88420
    휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG12074-NF229890
    휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그HG12074-NH229890
    휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG12074-NM229890
    휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG12074-NY229890
    휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmidHG12074-UT229890
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    연구배경

    Nucleophosmin 1 (NPM1), also known as nucleolar phosphoprotein B23 or numatrin, is a member of the nucleoplasmin family. Nucleophosmin (NPM) is a nucleolar phosphoprotein that plays multiple roles in ribosome assembly and transport, cytoplasmic-nuclear trafficking, centrosome duplication and regulation of p53. The NPM1 gene is frequently involved in chromosomal translocation, mutation and deletion. Mutations of the NPM1 gene leading to the expression of a cytoplasmic mutant protein, NPMc+, are the most frequent genetic abnormalities found in acute myeloid leukemias. Acute myeloid leukemias (AML) with mutated NPM1 have distinct characteristics, including a significant association with a normal karyotype, involvement of different hematopoietic lineages, a specific gene-expression profile and clinically, a better response to induction therapy and a favorable prognosis. In addition, NPM1 is a crucial gene to consider in the context of the genetics and biology of cancer. NPM1 is frequently overexpressed, mutated, rearranged and deleted in human cancer. Traditionally regarded as a tumour marker and a putative proto-oncogene, it has now also been attributed with tumour-suppressor functions.

    참고자료
  • Chen W, et al. (2006) Nucleophosmin gene mutations in acute myeloid leukemia. Arch Pathol Lab Med. 130(11): 1687-92.
  • Naoe T, et al. (2006) Nucleophosmin: a versatile molecule associated with hematological malignancies. Cancer Sci. 97(10): 963-9.
  • Grisendi S, et al. (2006) Nucleophosmin and cancer. Nat Rev Cancer. 6(7): 493-505.
  • Falini B, et al. (2007) Acute myeloid leukemia carrying cytoplasmic/mutated nucleophosmin (NPMc+ AML): biologic and clinical features. Blood. 109(3): 874-85.
  • Meani N, et al. (2009) Role of nucleophosmin in acute myeloid leukemia. Expert Rev Anticancer Ther. 9(9): 1283-94.
  • Size / Price
    Cat No: HG12074-CY
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".