After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Human NPM1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_002520
cDNA 크기:885bp
cDNA 설명:Full length Clone DNA of Homo sapiens nucleophosmin (nucleolar phosphoprotein B23, numatrin) with N terminal Flag tag.
유전자 동의어:B23, NPM
:Human
벡터:pCMV3-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그 on other vectors
휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG12074-ACG265260
휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG12074-ACR265260
휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG12074-ANG265260
휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG12074-ANR265260
휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG12074-CF229890
휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그HG12074-CH229890
휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG12074-CM229890
휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG12074-CY229890
휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone in cloning vectorHG12074-G88420
휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG12074-NF229890
휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그HG12074-NH229890
휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG12074-NM229890
휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG12074-NY229890
휴먼 NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmidHG12074-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Nucleophosmin 1 (NPM1), also known as nucleolar phosphoprotein B23 or numatrin, is a member of the nucleoplasmin family. Nucleophosmin (NPM) is a nucleolar phosphoprotein that plays multiple roles in ribosome assembly and transport, cytoplasmic-nuclear trafficking, centrosome duplication and regulation of p53. The NPM1 gene is frequently involved in chromosomal translocation, mutation and deletion. Mutations of the NPM1 gene leading to the expression of a cytoplasmic mutant protein, NPMc+, are the most frequent genetic abnormalities found in acute myeloid leukemias. Acute myeloid leukemias (AML) with mutated NPM1 have distinct characteristics, including a significant association with a normal karyotype, involvement of different hematopoietic lineages, a specific gene-expression profile and clinically, a better response to induction therapy and a favorable prognosis. In addition, NPM1 is a crucial gene to consider in the context of the genetics and biology of cancer. NPM1 is frequently overexpressed, mutated, rearranged and deleted in human cancer. Traditionally regarded as a tumour marker and a putative proto-oncogene, it has now also been attributed with tumour-suppressor functions.

참고자료
  • Chen W, et al. (2006) Nucleophosmin gene mutations in acute myeloid leukemia. Arch Pathol Lab Med. 130(11): 1687-92.
  • Naoe T, et al. (2006) Nucleophosmin: a versatile molecule associated with hematological malignancies. Cancer Sci. 97(10): 963-9.
  • Grisendi S, et al. (2006) Nucleophosmin and cancer. Nat Rev Cancer. 6(7): 493-505.
  • Falini B, et al. (2007) Acute myeloid leukemia carrying cytoplasmic/mutated nucleophosmin (NPMc+ AML): biologic and clinical features. Blood. 109(3): 874-85.
  • Meani N, et al. (2009) Role of nucleophosmin in acute myeloid leukemia. Expert Rev Anticancer Ther. 9(9): 1283-94.
  • Size / Price
    Cat No: HG12074-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".