After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 METTL11A Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Human NTMT1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_014064.2
cDNA 크기:672bp
cDNA 설명:Full length Clone DNA of Homo sapiens N-terminal Xaa-Pro-Lys N-methyltransferase 1 with N terminal Flag tag.
유전자 동의어:AD-003, C9orf32, METTL11A
:Human
벡터:pCMV3-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Methyltransferase-like protein 11A, also known as METTL11A, is a member of the methyltransferase superfamily and METTL11 family. Methyltransferase is a type of transferase enzyme which transfers a methyl group from a donor to an acceptor. Methylation often occurs on nucleic bases in DNA or amino acids in protein structures. Methytransferase uses a reactive methyl group bound to sulfur in S-adenosyl methionine (SAM) as the methyl donor. DNA methylation is often utilized to silence and regulate genes without changing the original DNA sequence. This methylation occurs on cytosine residues. DNA methylation may be necessary for normal growth from embryonic stages in mammals. Methylation can serve to protect DNA from enzymatic cleavage, since restriction enzymes are unable to bind and recognize externally modified sequences. This is especially useful in bacterial restriction modification systems which use restriction enzymes to cleave foreign DNA while keeping their own DNA protected by methylation. Methylation of amino acids in the formation of proteins leads to more diversity of possible amino acids and therefore more diversity of function. The methylation reaction occurs on nitrogen atoms either on the N terminus or side-chain position of the protein and are usually irreversible.

Size / Price
Cat No: HG11222-NF
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보2-3 weeks
대량 주문 문의장바구니에 추가
Contact Us
이미지
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".