OCIAD2 cDNA ORF Clone, Human, C-His tag

Cat: HG13996-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All OCIAD2 Reagents

CRO Services

Product recommended


All OCIAD2 Reagents

OCIAD2 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
300 bp
Description
Full length Clone DNA of Human OCIA domain containing 2 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OCIAD2 Background Information

Full Name
OCIA domain containing 2

OCIAD2 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
OCIAD2 cDNA ORF Clone in Cloning Vector, Rabbit TG65102-G
OCIAD2 cDNA ORF Clone, Rabbit, untagged TG65102-UT
OCIAD2 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65102-ACG
OCIAD2 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65102-ANG
OCIAD2 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65102-ACR
OCIAD2 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65102-ANR
OCIAD2 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65102-CF
OCIAD2 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65102-NF
OCIAD2 cDNA ORF Clone, Rabbit, C-His tag TG65102-CH
OCIAD2 cDNA ORF Clone, Rabbit, N-His tag TG65102-NH
OCIAD2 cDNA ORF Clone, Rabbit, C-HA tag TG65102-CY
OCIAD2 cDNA ORF Clone, Rabbit, N-HA tag TG65102-NY
OCIAD2 cDNA ORF Clone, Rabbit, C-Myc tag TG65102-CM
OCIAD2 cDNA ORF Clone, Rabbit, N-Myc tag TG65102-NM

OCIAD2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
OCIAD2 cDNA ORF Clone in Cloning Vector, Human HG13996-G
OCIAD2 cDNA ORF Clone, Human, untagged HG13996-UT
OCIAD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13996-ACGLN
OCIAD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13996-ACG
OCIAD2 cDNA ORF Clone, Human, N-GFPSpark® tag HG13996-ANG
OCIAD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13996-ACR
OCIAD2 cDNA ORF Clone, Human, N-OFPSpark® tag HG13996-ANR
OCIAD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13996-CF
OCIAD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13996-NF
OCIAD2 cDNA ORF Clone, Human, N-His tag HG13996-NH
OCIAD2 cDNA ORF Clone, Human, C-HA tag HG13996-CY
OCIAD2 cDNA ORF Clone, Human, N-HA tag HG13996-NY
OCIAD2 cDNA ORF Clone, Human, C-Myc tag HG13996-CM
OCIAD2 cDNA ORF Clone, Human, N-Myc tag HG13996-NM
OCIAD2 qPCR Primer Pairs, Human HP102652
info info
添加购物车成功! 添加购物车失败!