After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 ORM2 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human ORM2 cDNA 클론 제품 정보
Gene_bank_ref_id:BC015964
cDNA 크기:607bp
cDNA 설명:Full length Clone DNA of Homo sapiens orosomucoid 2.
유전자 동의어:AGP2, AGP-B, AGP-B', ORM2
:Human
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
연구배경

ORM2 belongs to the calycin superfamily, lipocalin family. Lipocalins share limited regions of sequence homology and a common tertiary structure architecture. They transport small hydrophobic molecules such as steroids, bilins, retinoids, and lipids. Lipocalins can be found in gram negative bacteria, vertebrate cells, and invertebrate cells, and in plants. They are associated with many biological processes. ORM2 functions as transport protein in the blood stream. It is expressed by the liver and secreted in plasma. It seems that ORM2 function in modulating the activity of the immune system during the acute-phase reaction. It binds various hydrophobic ligands in the interior of its beta-barrel domain. It also binds synthetic drugs and influences their distribution and availability.

참고자료
  • Davila S, et al. (2010) New genetic associations detected in a host response study to hepatitis B vaccine. Genes Immun. 11(3):232-8.
  • Zhang X, et al. (2012) The potential role of ORM2 in the development of colorectal cancer. PLoS One. 7(2):e31868.
  • Size / Price
    Cat No: HG13299-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".