OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, C-HA tag

Cat: HG12057-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All OTC/Ornithine Carbamoyltransferase Reagents

CRO Services

Product recommended


All OTC/Ornithine Carbamoyltransferase Reagents

OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1065 bp
Description
Full length Clone DNA of Human ornithine carbamoyltransferase with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, C-HA tag Alternative Names

OCTD cDNA ORF Clone, Human

OTC/Ornithine Carbamoyltransferase Background Information

Full Name
ornithine carbamoyltransferase

OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone in Cloning Vector, Rat RG80649-U
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, untagged RG80649-UT
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, C-GFPSpark® tag RG80649-ACG
OTC/Ornithine Carbamoyltransferase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80649-ACGLN
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, N-GFPSpark® tag RG80649-ANG
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, C-OFPSpark® tag RG80649-ACR
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, N-OFPSpark® tag RG80649-ANR
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80649-CF
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80649-NF
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, C-His tag RG80649-CH
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, N-His tag RG80649-NH
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, C-HA tag RG80649-CY
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, N-HA tag RG80649-NY
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, C-Myc tag RG80649-CM
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Rat, N-Myc tag RG80649-NM
OTC/Ornithine Carbamoyltransferase qPCR Primer Pairs, Rat RP300613

OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone in Cloning Vector, Mouse MG53756-U
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, untagged MG53756-UT
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53756-ACG
OTC/Ornithine Carbamoyltransferase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53756-ACGLN
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53756-ANG
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53756-ACR
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53756-ANR
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53756-CF
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53756-NF
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, C-His tag MG53756-CH
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, N-His tag MG53756-NH
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, C-HA tag MG53756-CY
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, N-HA tag MG53756-NY
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, C-Myc tag MG53756-CM
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Mouse, N-Myc tag MG53756-NM

OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone in Cloning Vector, Human HG12057-G
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, untagged HG12057-UT
OTC/Ornithine Carbamoyltransferase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12057-ACGLN
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, C-GFPSpark® tag HG12057-ACG
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, N-GFPSpark® tag HG12057-ANG
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, C-OFPSpark® tag HG12057-ACR
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, N-OFPSpark® tag HG12057-ANR
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12057-CF
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12057-NF
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, C-His tag HG12057-CH
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, N-His tag HG12057-NH
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, N-HA tag HG12057-NY
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, C-Myc tag HG12057-CM
OTC/Ornithine Carbamoyltransferase cDNA ORF Clone, Human, N-Myc tag HG12057-NM
OTC/Ornithine Carbamoyltransferase qPCR Primer Pairs, Human HP101588
info info
添加购物车成功! 添加购物车失败!