Text Size:AAA

휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human PARP3 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_005485.4
cDNA 크기:1602bp
cDNA 설명:Full length Clone DNA of Homo sapiens poly (ADP-ribose) polymerase family, member 3, transcript variant 2.
유전자 동의어:IRT1, ADPRT3, ADPRTL2, ADPRTL3, PADPRT-3, PARP3
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-PARP3
제한 사이트:KpnI + XbaI (6.1kb + 1.6kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human PARP3 Gene Plasmid Map
Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid on other vectors
휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG11190-ACG288840
휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG11190-ACR288840
휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG11190-ANG288840
휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG11190-ANR288840
휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11190-CF253470
휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His 태그HG11190-CH253470
휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG11190-CM253470
휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA 태그HG11190-CY253470
휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone in cloning vectorHG11190-M88420
휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11190-M-F253470
휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG11190-NF253470
휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His 태그HG11190-NH253470
휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG11190-NM253470
휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA 태그HG11190-NY253470
휴먼 PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmidHG11190-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
참고자료
  • Loseva O, et al. (2010) PARP-3 is a mono-ADP-ribosylase that activates PARP-1 in the absence of DNA. J Biol Chem. 285(11): 8054-60.
  • Lehtio L, et al. (2009) Structural basis for inhibitor specificity in human poly(ADP-ribose) polymerase-3. J Med Chem. 52(9): 3108-11.
  • Rouleau M, et al. (2009) Assessment of PARP-3 distribution in tissues of cynomolgous monkeys. J Histochem Cytochem. 57(7): 675-85.
  • Rouleau M, et al. (2007) PARP-3 associates with polycomb group bodies and with components of the DNA damage repair machinery. J Cell Biochem. 100(2): 385-401.
  • Augustin A, et al. (2003) PARP-3 localizes preferentially to the daughter centriole and interferes with the G1/S cell cycle progression. J Cell Sci. 116(Pt 8): 1551-62.
  • Size / Price
    Cat No: HG11190-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".