PCBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11628-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PCBP1 Reagents

CRO Services

Product recommended


All PCBP1 Reagents

PCBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1110 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human poly(rC) binding protein 1 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + NotI(6kb+1.11kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PCBP1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PCBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images

Human STAT3 Gene Plasmid Map 5680

PCBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

HEL-S-85 cDNA ORF Clone, Human;hnRNP-E1 cDNA ORF Clone, Human;hnRNP-X cDNA ORF Clone, Human;HNRPE1 cDNA ORF Clone, Human;HNRPX cDNA ORF Clone, Human

PCBP1 Background Information

Poly(rC)-binding protein 1, also known as Heterogeneous nuclear ribonucleoprotein E1, Alpha-CP1, Nucleic acid-binding protein SUB2.3 and PCBP1, is a family member of heterogeneous nuclear ribonucleoproteins (hnRNPs) that belong to RNA-binding proteins and bear three KH domains. PCBP1 is loosely bound in the nucleus. It may shuttle between the nucleus and the cytoplasm. It is abundantly expressed in skeletal muscle, thymus and peripheral blood leukocytes while a lower expression is observed in prostate, spleen, testis, ovary, small intestine, heart, liver, adrenal and thyroid glands. PCBP1 is widely expressed in many human tissues and involved in regulation of transcription, transportation process, and function of RNA molecules. PCBP1 plays a pivotal role in post-transcriptional regulation for RNA metabolism and RNA function in gene expression. PCBP1 acts as a negative regulator of CD44 variants splicing in HepG2 cells, and loss of PCBP1 in human hepatic tumor contributes to the formation of a metastatic phenotype.

Full Name
poly(rC) binding protein 1
References
  • Evans,J.R. et al., 2003, Oncogene  22 (39): 8012-20.
  • Huo,L.R. et al., 2008, Biochim Biophys Acta  1784 (11):1524-33.
  • Huo,L.R. et al., 2009, Beijing Da Xue Xue Bao  41 (4):402-8.
  • Zhang,T. et al., 2010, Mol Cancer 9 :72.
  • PCBP1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PCBP1 cDNA ORF Clone, Mouse, untagged MG5A0713-UT
    PCBP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0713-ACGLN
    PCBP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0713-ACG
    PCBP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0713-ANG
    PCBP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0713-ACR
    PCBP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0713-ANR
    PCBP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0713-CF
    PCBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0713-NF
    PCBP1 cDNA ORF Clone, Mouse, C-His tag MG5A0713-CH
    PCBP1 cDNA ORF Clone, Mouse, N-His tag MG5A0713-NH
    PCBP1 cDNA ORF Clone, Mouse, C-HA tag MG5A0713-CY
    PCBP1 cDNA ORF Clone, Mouse, N-HA tag MG5A0713-NY
    PCBP1 cDNA ORF Clone, Mouse, C-Myc tag MG5A0713-CM
    PCBP1 cDNA ORF Clone, Mouse, N-Myc tag MG5A0713-NM

    PCBP1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PCBP1 cDNA ORF Clone in Cloning Vector, Human HG11628-M
    PCBP1 cDNA ORF Clone, Human, untagged HG11628-UT
    PCBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11628-ACGLN
    PCBP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11628-ACG
    PCBP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11628-ANG
    PCBP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11628-ACR
    PCBP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11628-ANR
    PCBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11628-NF
    PCBP1 cDNA ORF Clone, Human, C-His tag HG11628-CH
    PCBP1 cDNA ORF Clone, Human, N-His tag HG11628-NH
    PCBP1 cDNA ORF Clone, Human, C-HA tag HG11628-CY
    PCBP1 cDNA ORF Clone, Human, N-HA tag HG11628-NY
    PCBP1 cDNA ORF Clone, Human, C-Myc tag HG11628-CM
    PCBP1 cDNA ORF Clone, Human, N-Myc tag HG11628-NM
    PCBP1 qPCR Primer Pairs, Human HP101442
    info info
    添加购物车成功! 添加购物车失败!