휴먼 PDCD4 transcript variant 1 Gene ORF cDNA clone expression plasmid

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
데이터시트리뷰관련제품프로토콜
휴먼 PDCD4 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_014456.3
cDNA 크기:1410 bp
cDNA 설명:Full length Clone DNA of Homo sapiens programmed cell death 4 (neoplastic transformation inhibitor), transcript variant 1.
유전자 동의어:H731
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-PDCD4
제한 사이트:KpnI + XbaI(6.1kb+1.41kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PDCD4 qPCR primers for gene expression analysis, HP101098 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
휴먼 PDCD4 transcript variant 1 Gene ORF cDNA clone expression plasmid on other vectors
휴먼 PDCD4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG11193-ACG265260
휴먼 PDCD4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG11193-ACR265260
휴먼 PDCD4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG11193-ANG265260
휴먼 PDCD4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG11193-ANR265260
휴먼 PDCD4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG11193-CF229890
휴먼 PDCD4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그HG11193-CH229890
휴먼 PDCD4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG11193-CM229890
휴먼 PDCD4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG11193-CY229890
휴먼 PDCD4 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG11193-M88420
휴먼 PDCD4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG11193-NF229890
휴먼 PDCD4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그HG11193-NH229890
휴먼 PDCD4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG11193-NM229890
휴먼 PDCD4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG11193-NY229890
휴먼 PDCD4 transcript variant 1 Gene ORF cDNA clone expression plasmidHG11193-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: HG11193-UT
정가: 
가격:      (You Save: )

Datasheet & Documentation

Contact Us
    최근에 조회한 품목
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".